Encode id - ENm003:stSG601807 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw APOA4/APOC3 APOA4/APOC3 USER DEFINED 2857 POSITIVE OUTCOME 9366246 0 search_space EMPTY 0 false 0 sequence TCAAACCAGGGGTCAGTCCAGAGGTCAGAGTCA 0 false 0 sequence_with_flank cattagctacagccacccctcctggccaaccacacagggaTCAAACCAGGGGTCAGTCCAGAGGTCAGAGTCAggagcagacaactcagatccagccagggacaggcaggtca 0 false Homo sapiens OREG0001802 3172 HNF4A NCBI TRANSCRIPTION FACTOR BINDING SITE Encode ID - ENm003:stSG601804 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 337 APOA4 NCBI 2858 POSITIVE OUTCOME 15583007 0 search_space EMPTY 0 false 0 sequence TAGTCTCAGGGTCACAAAAGTCCAAGAGGCC 0 false 0 sequence_with_flank taactatcgcctgagccctgatctgctgtcagcttccacgTAGTCTCAGGGTCACAAAAGTCCAAGAGGCCtcttgggaatgtgtcaccttccagcgtggagtcacactg 0 false Homo sapiens OREG0001803 3172 HNF4A NCBI TRANSCRIPTION FACTOR BINDING SITE Encode ID - ENm003:stSG601804 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 337 APOA4 NCBI 2859 POSITIVE OUTCOME 15583007 0 search_space EMPTY 0 false 0 sequence GGAGATGTGGACTTTGCCCCCCATGAGCCC 0 false 0 sequence_with_flank gtggagactggggggacctgtcttcactggggtagacagaGGAGATGTGGACTTTGCCCCCCATGAGCCCggcacaaacccagagccgccagcagggcctcgaggcatca 0 false Homo sapiens OREG0001804 3172 HNF4A NCBI TRANSCRIPTION FACTOR BINDING SITE Encode ID - ENm003:stSG601810 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 345 APOC3 NCBI 2860 POSITIVE OUTCOME 7984419 0 search_space EMPTY 0 false 0 sequence GGTCAGCAGGTGACCTTTGCCCAGCG 0 false 0 sequence_with_flank gctgcatctggacaccctgcctcaggccctcatctccactGGTCAGCAGGTGACCTTTGCCCAGCGccctgggtcctcagtgcctgctgccctggagatgatataa 0 false Homo sapiens OREG0001805 3172 HNF4A NCBI TRANSCRIPTION FACTOR BINDING SITE Encode ID - ENr132:stSG621988 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 2159 F10 NCBI 2861 POSITIVE OUTCOME 8567696 0 search_space EMPTY 0 false 0 sequence TCCCAGCTGGGGCGTGGACTTTGCTCCA 0 false 0 sequence_with_flank ggaggcctaagccaagtgataagcagccagacaacagccaTCCCAGCTGGGGCGTGGACTTTGCTCCAgcagcctgtcccagtgaggacagggacacagtactcggcc 0 false Homo sapiens OREG0001806 3172 HNF4A NCBI TRANSCRIPTION FACTOR BINDING SITE Encode ID - ENm003:stSG601817 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 335 APOA1 NCBI 2862 POSITIVE OUTCOME 8626539 0 search_space EMPTY 0 false 0 sequence CCGCCCCCACTGAACCCTTGACCCCTGCCCT 0 false 0 sequence_with_flank ccccacccgggagacctgcaagcctgcagacactcccctcCCGCCCCCACTGAACCCTTGACCCCTGCCCTgcagcccccgcagcttgctgtttgcccactctatttgcc 0 false Homo sapiens OREG0001807 3172 HNF4A NCBI TRANSCRIPTION FACTOR BINDING SITE Encode ID - ENm003:stSG601817 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 335 APOA1 NCBI 2863 POSITIVE OUTCOME 8626539 0 search_space EMPTY 0 false 0 sequence CCTTGAACTCTTAAGTTCCACATTGCCAGGACCAGTGAGCAGCAACAGGGCC 0 false 0 sequence_with_flank ttgcccactctatttgcccagccccagggacagagctgatCCTTGAACTCTTAAGTTCCACATTGCCAGGACCAGTGAGCAGCAACAGGGCCggggctgggcttatcagcctcccagcccagaccctggctg 0 false Homo sapiens OREG0001810 3172 HNF4A NCBI TRANSCRIPTION FACTOR BINDING SITE Encode ID - ENm003:stSG601817 16-Nov-2005 claesw 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 335 APOA1 NCBI 2864 POSITIVE OUTCOME 7961760 0 search_space EMPTY 0 false 0 sequence TGCCCACTCTATTTGCCCAGCCCCAG 0 false 0 sequence_with_flank acccttgacccctgccctgcagcccccgcagcttgctgttTGCCCACTCTATTTGCCCAGCCCCAGggacagagctgatccttgaactcttaagttccacattgcc 0 false Homo sapiens OREG0001811 3170 FOXA2 NCBI TRANSCRIPTION FACTOR BINDING SITE 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 345 APOC3 NCBI 2865 POSITIVE OUTCOME 11839757 0 search_space EMPTY 0 false 0 sequence GGTCAGCAGGTGACCTTTGCCCAGCG 0 false 0 sequence_with_flank gctgcatctggacaccctgcctcaggccctcatctccactGGTCAGCAGGTGACCTTTGCCCAGCGccctgggtcctcagtgcctgctgccctggagatgatata 0 false Homo sapiens OREG0001813 7391 USF1 NCBI TRANSCRIPTION FACTOR BINDING SITE 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 116519 APOA5 NCBI 2866 POSITIVE OUTCOME 15684402 0 search_space EMPTY 0 false 0 sequence CTTCCACGTGGTATTTA 0 false 0 sequence_with_flank ggaggtgagtgctgggaggcagctgaggtcaacttcttttgaaCTTCCACGTGGTATTTActcagagcaattggtgccagaggctcagggccctggagtataaagcagaa 0 false Homo sapiens OREG0001814 7391 USF1 NCBI TRANSCRIPTION FACTOR BINDING SITE 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 345 APOC3 NCBI 2867 POSITIVE OUTCOME 2161843 0 search_space EMPTY 0 false 0 sequence CTCAGTCTCCTAGGGATTTCCCAACTCTCCCGCCC 0 false 0 sequence_with_flank gctcatctgggctgcagggctggcgggacagcagcgtggaCTCAGTCTCCTAGGGATTTCCCAACTCTCCCGCCCgcttgctgcatctggacaccctgcctcaggccctcatctc 0 false Homo sapiens OREG0001815 1050 CEBPA NCBI TRANSCRIPTION FACTOR BINDING SITE 16-Nov-2005 16-Nov-2005 OREGEC00000 OREGES00000 OREGET00000 claesw 335 APOA1 NCBI 2868 POSITIVE OUTCOME 1900840 0 search_space EMPTY 0 false 0 sequence GCTTGCTGTTTGCCCACTCTATTTG 0 false 0 sequence_with_flank cccccactgaacccttgacccctgccctgcagcccccgcaGCTTGCTGTTTGCCCACTCTATTTGcccagccccagggacagagctgatccttgaactcttaagt 0 false Homo sapiens OREG0001816 1050 CEBPA NCBI TRANSCRIPTION FACTOR BINDING SITE Homo sapiens 9606 claesw 29-Nov-2006 DNAse1 footprinting is in reference 14: Roberts MR, Miskinins WK and Ruddle FH 1989, Cell Regul. 1:151-164 29-Nov-2006 OREGEC00000 OREGES00015 OREGET00003 agrobertson 29-Nov-2006 OREGEC00000 OREGES00003 OREGET00001 agrobertson ENSG00000072274 TFRC ENSEMBL homo_sapiens_core_41_36c 4131 POSITIVE OUTCOME 8022786 0 search_space EMPTY 0 false 0 sequence AAGTGACG 0 false 0 sequence_with_flank cgcgagcgtacgtgcctcaggAAGTGACGcacagcccccctgggggc 0 false Homo sapiens OREG0002488 ENSG00000079246 XRCC5 ENSEMBL homo_sapiens_core_41_36c TRANSCRIPTION FACTOR BINDING SITE 1 There is an NF-kB site TAAAATTCCCC about 20bp 5' of the C/EBP site. The two TF's act synergistically. 2 How the different C/EBP family members reacted in EMSA depended on whether cells were HKLM-activated or not. 30-Nov-2006 agrobertson 30-Nov-2006 EV:0200085 30-Nov-2006 OREGEC00000 OREGES00013 OREGET00001 agrobertson EV:0200085 30-Nov-2006 OREGEC00000 OREGES00015 OREGET00003 agrobertson ENSMUSG00000004296 Il12b ENSEMBL mus_musculus_core_41_36b 4215 POSITIVE OUTCOME 9234715 0 search_space EMPTY 0 false 0 sequence GTGTTGCAA 0 false 0 sequence_with_flank gacactagttttcaGTGTTGCAAttgagactagtcagttt 0 false Mus musculus OREG0002555 C/EBPalpha/beta/gamma C/EBPalpha/beta/gamma USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Homo sapiens 9606 Mus musculus 10090 agrobertson 13-Apr-2006 21-Apr-2006 OREG0001911 dvlieghe 13-Apr-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe 999 CDH1 NCBI 2941 POSITIVE OUTCOME 11430829 0 search_space EMPTY 0 false 0 sequence CAGGTGAACCCTCAGCCAATCAGCGGTACGGGGGGCGGTGCCTCCGGGGCTCACCTG 0 false 0 sequence_with_flank CCCTGGGGAGGGGTCCGCGCTGCTGATTGGCTGTGGCCGGCAGGTGAACCCTCAGCCAATCAGCGGTACGGGGGGCGGTGCCTCCGGGGCTCACCTGGCTGCAGCCACGCACCCCCTCTC 0 false Homo sapiens OREG0001888 8487 SIP1 NCBI TRANSCRIPTION FACTOR BINDING SITE element 1 of Figure 8B (-1276) 18-Apr-2006 dvlieghe 18-Apr-2006 Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00000 OREGET00009 dvlieghe 2706 GJB2 NCBI 2951 POSITIVE OUTCOME 16314317 0 search_space EMPTY 0 false 0 sequence AGGTG 0 false 0 sequence_with_flank AATCGCGAAGTGGGTGCCCGAGGTGGGGCGGGGGTTGGGGGAGAC 0 false Homo sapiens OREG0001890 9839 ZFHX1B NCBI TRANSCRIPTION FACTOR BINDING SITE element 2 of Figure 8B (-1075) 18-Apr-2006 dvlieghe 18-Apr-2006 Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00000 OREGET00009 dvlieghe 2706 GJB2 NCBI 2952 POSITIVE OUTCOME 16314317 0 search_space EMPTY 0 false 0 sequence CAGGTG 0 false 0 sequence_with_flank GGTATCCAGAAAGCCCCCAGCAGGTGTGCAGTGCAGAGCCAGCCCC 0 false Homo sapiens OREG0001894 9839 ZFHX1B NCBI TRANSCRIPTION FACTOR BINDING SITE element 3 of Figure 8B (-917) 18-Apr-2006 dvlieghe 18-Apr-2006 Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00000 OREGET00009 dvlieghe 2706 GJB2 NCBI 2953 POSITIVE OUTCOME 16314317 0 search_space EMPTY 0 false 0 sequence CACCT 0 false 0 sequence_with_flank CTCCTCACCCCGAAAGGAGTCACCTCCTTGCAGTTCCCCAGTTGC 0 false Homo sapiens OREG0001897 9839 ZFHX1B NCBI TRANSCRIPTION FACTOR BINDING SITE element 4 of Figure 8B (-39) 18-Apr-2006 dvlieghe 18-Apr-2006 Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe Figure 8 ... (C) Promoter activity assays on extracts of transfected MCF7/AZ cells. Cells were co-transfected with a SIP1 expression vector and luciferase promoter constructs for E-cadherin, P-cadherin, claudin 4 or connexin 26. Co-expression of SIP1 with the promoter constructs resulted in downregulation of promoter activities. Mutation of all 4 SIP1-binding elements in the connexin 26 promoter (see B) relieved the repressive activity of SIP1. Mutation of less than 4 SIP1-binding sequences preserved the repressive effect of SIP1. 18-Apr-2006 OREGEC00001 OREGES00000 OREGET00009 dvlieghe 2706 GJB2 NCBI 2954 POSITIVE OUTCOME 16314317 0 search_space EMPTY 0 false 0 sequence CAGGTG 0 false 0 sequence_with_flank AAAGGCGCCACGGCGGGAGACAGGTGTTGCGGCCCCGCAGCGCCCG 0 false Homo sapiens OREG0001898 9839 ZFHX1B NCBI TRANSCRIPTION FACTOR BINDING SITE p53RE1 element 19-Apr-2006 dvlieghe 19-Apr-2006 A p53 consensus element located in a region spanning from nucleotide –1329 to –1302 relative to the ATG start codon is not necessary for doxorubicin-induced transactivation of the human CD95 gene in MCF-7 cells. A, MCF-7Neo and MCF-7E6 cells were incubated in the presence or in the absence of 500 ng/ml doxorubicin for 8 h and CD95 mRNA was detected by Northern blot analysis. B, D, F, cells were transfected with 0.5 µg of the indicated luciferase reporter plasmids. 10 h after transfection cells were treated with or without 500 ng/ml doxorubicin for an additional 15 h before luciferase activity was determined. C and E, MCF-7 cells were co-transfected with 0.5 µg of the indicated luciferase reporter plasmids and 0.5 µg of wild-type p53 (wt p53), mutant p53 (m p53), or empty vectors. Luciferase activity was measured 48 h after transfection. Results are representative of at least two independent experiments. 19-Apr-2006 OREGEC00001 OREGES00026 OREGET00002 dvlieghe 355 FAS NCBI 2960 NEGATIVE OUTCOME 12788915 0 search_space EMPTY 0 false 0 sequence AGACAAGCCTATCAACACCTACAAGACT 0 false 0 sequence_with_flank tctactgaaaggtggaacagAGACAAGCCTATCAACACCTACAAGACTggtggtaagtgcagtgacag 0 false Homo sapiens OREG0001906 7157 TP53 NCBI TRANSCRIPTION FACTOR BINDING SITE p53RE2 element 19-Apr-2006 dvlieghe 19-Apr-2006 A functional contribution of the p53-RE2 motif to the p53-mediated transcriptional activity of the pI-CD95 391Luc plasmid was excluded in experiments using a construction containing a shorter promoter fragment together with the intronic element (pI-CD95 170Luc). These results (Fig. 2A) demonstrated that elimination of the –391 to –171 bp region containing the p53-RE2 site failed to affect doxorubicin-induced transcriptional activation when compared with pI-CD95 391Luc construct. Furthermore, site-directed mutagenesis of both p53-RE2 and p53-RE3 in pI-CD95 391Luc (pI-CD95 m391Luc) did not result in loss of transcriptional activity (Fig. 2A) 19-Apr-2006 OREGEC00001 OREGES00026 OREGET00002 dvlieghe Furthermore, site-directed mutagenesis of both p53-RE2 and p53-RE3 in pI-CD95 391Luc (pI-CD95 m391Luc) did not result in loss of transcriptional activity (Fig. 2A) 19-Apr-2006 OREGEC00001 OREGES00000 OREGET00009 dvlieghe 355 FAS NCBI 2961 NEGATIVE OUTCOME 12788915 0 search_space EMPTY 0 false 0 sequence GCGCAAGAGTGACACACAGGTGT 0 false 0 sequence_with_flank gtgagctcgtctctgatctcGCGCAAGAGTGACACACAGGTGTtcaaagacgcttctggggag 0 false Homo sapiens OREG0001908 7157 TP53 NCBI TRANSCRIPTION FACTOR BINDING SITE 21-Apr-2006 21-Apr-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe 999 CDH1 NCBI 2964 POSITIVE OUTCOME 11430829 0 search_space EMPTY 0 false 0 sequence CAGGTGAACCCTCAGCCAATCAGCGGTACGGGGGGCGGTGCCTCCGGGGCTCACCTG 0 false 0 sequence_with_flank CCCTGGGGAGGGGTCCGCGCTGCTGATTGGCTGTGGCCGGCAGGTGAACCCTCAGCCAATCAGCGGTACGGGGGGCGGTGCCTCCGGGGCTCACCTGGCTGCAGCCACGCACCCCCTCTC 0 false Homo sapiens OREG0001911 9839 ZFHX1B NCBI TRANSCRIPTION FACTOR BINDING SITE 29-Nov-2006 We examined whether these sequences were recognized by GST/Ci-ZicL(ZF). As shown in Fig. 3C, the –123 (lane 3) and –168 (lane 4) sequences bound to the fusion protein with a similar affinity as ZicL-b (lane 2), while –731 (lane 6) bound less tightly. Therefore, it is highly likely that Ci-ZicL recognizes the –123 and –168 upstream sequences of Ci-Bra (hereafter designated ZicL-b1 and ZicL-b2, respectively), suggesting the possibility that Ci-ZicL acts as a direct activator of Ci-Bra 29-Nov-2006 OREGEC00001 OREGES00001 OREGET00001 dvlieghe 778911 brachyury NCBI 4083 POSITIVE OUTCOME 14993185 0 search_space GTGGTGGCATCCAGCTGTGAGG 0 false 0 sequence CCAGCTGTG 0 false 0 sequence_with_flank cataacttcttctttttgaaattttatgtttgttgaaagtgcgccgtagGTGGTGGCATCCAGCTGTGAGGgttgctcgtgtggtggcgctctatgttt 0 false Ciona intestinalis OREG0002385 778798 zicl NCBI TRANSCRIPTION FACTOR BINDING SITE 29-Nov-2006 We examined whether these sequences were recognized by GST/Ci-ZicL(ZF). As shown in Fig. 3C, the –123 (lane 3) and –168 (lane 4) sequences bound to the fusion protein with a similar affinity as ZicL-b (lane 2), while –731 (lane 6) bound less tightly. Therefore, it is highly likely that Ci-ZicL recognizes the –123 and –168 upstream sequences of Ci-Bra (hereafter designated ZicL-b1 and ZicL-b2, respectively), suggesting the possibility that Ci-ZicL acts as a direct activator of Ci-Bra. 29-Nov-2006 OREGEC00000 OREGES00001 OREGET00001 dvlieghe 778911 brachyury NCBI 4089 POSITIVE OUTCOME 14993185 0 search_space GGTGTTCGATCCAGCTGTGAAA 0 false 0 sequence CAGCTGTG 0 false 0 sequence_with_flank ggtgacgtcatatcactaaaacaaacacaaGGTGTTCGATCCAGCTGTGAAAgtaaacatagagcgccaccacacgagca 0 false Ciona intestinalis OREG0002422 778798 zicl NCBI TRANSCRIPTION FACTOR BINDING SITE 30-Nov-2006 cell line: RPMI 8226 We then analyzed the effect of IFN-{alpha} on the human IL-10 promoter by studying a luciferase reporter construct with the -195 bp IL-10 promoter, which contains both the Stat and the IRF motif. IFN-{alpha} stimulation of RPMI 8226 cells transfected with this construct led to an average 5-fold trans-activation (Fig. 4, left panel,) comparable to what was observed with LPS stimulation (). The combination of both stimuli did not lead to a further increase (). To demonstrate the importance of the IRF site for the IFN-{alpha}-induced trans-activation, we mutated the respective motif. This led, in fact, to a clear reduction of IFN-{alpha}-induced trans-activation (Fig. 4, second panel), but some activity (2-fold trans-activation) remained. This indicates that IFN-{alpha} can induce the human IL-10 promoter most likely via another motif, in addition to the IRF motif that was mutated in this construct. By contrast, trans-activation induced by LPS was similar for the wild type and the IRF mutant, indicating that for LPS-induced trans-activation the IRF motif is not required. 30-Nov-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe cell line: RPMI 8226 We then analyzed the effect of IFN-{alpha} on the human IL-10 promoter by studying a luciferase reporter construct with the -195 bp IL-10 promoter, which contains both the Stat and the IRF motif. IFN-{alpha} stimulation of RPMI 8226 cells transfected with this construct led to an average 5-fold trans-activation (Fig. 4, left panel,) comparable to what was observed with LPS stimulation (). The combination of both stimuli did not lead to a further increase (). To demonstrate the importance of the IRF site for the IFN-{alpha}-induced trans-activation, we mutated the respective motif. This led, in fact, to a clear reduction of IFN-{alpha}-induced trans-activation (Fig. 4, second panel), but some activity (2-fold trans-activation) remained. This indicates that IFN-{alpha} can induce the human IL-10 promoter most likely via another motif, in addition to the IRF motif that was mutated in this construct. By contrast, trans-activation induced by LPS was similar for the wild type and the IRF mutant, indicating that for LPS-induced trans-activation the IRF motif is not required. 30-Nov-2006 OREGEC00001 OREGES00041 OREGET00009 dvlieghe When performing supershift analysis, the gels were run for longer periods of time to better separate the specific binding complex. Using anti-IRF Abs under these conditions we could shift most of the binding protein with the anti-IRF-1 Ab (Fig. 1B, lane 3). A weak band with somewhat slower mobility remained, and this was supershifted with the anti-IRF-2 Ab (Fig. 1B, lane 4). The combination of both Abs removed both of the specific IRF bands (Fig. 1B, last lane). These data indicate that the specific complex consists of a minor IRF-2 band with lower mobility and a major IRF-1 band with higher mobility. 30-Nov-2006 OREGEC00001 OREGES00002 OREGET00001 dvlieghe Gel-shift analysis with nuclear extracts from IFN-{alpha}-stimulated cells revealed an inducible band (arrowhead in Fig. 1A). This band was not affected by an admixture of unlabeled Stat motif, but it was specifically competed by unlabeled IRF-motif (Fig. 1A). The nonspecific band marked by an asterisk in Fig. 1 was competed by both the specific IRF oligonucleotide and the nonspecific Stat oligonucleotide, indicating that this band cannot be involved in specific binding to the IRF motif. 30-Nov-2006 OREGEC00001 OREGES00001 OREGET00001 dvlieghe 3586 IL10 NCBI 4179 POSITIVE OUTCOME 12817009 0 search_space GCTTACGATGCAAAAATTGAAAACTAAGTTTATTAGAGAGGTTAGAGAAGGAGGAGCTCTAAGGAGAAAAAATCCTGTGCCGGGAAACCTTGATTGTGGCTTTTTAATGAATGAAGAGGCCTCCCTGAGCTTACAATATAAAAGGGGGACAGAGAGGTGAAGGTCTACACATCAGGGGCTTGCTCTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGC 0 false 0 sequence AATTGAAA 0 false 0 sequence_with_flank GCTTACGATGCAAAAATTGAAAACTAAGTTTATTAGAGAGGTTAGAGAAGGAGGAGCTCTAAGGAGAAAAAATCCTGTGCCGGGAAACCTTGATTGTGGCTTTTTAATGAATGAAGAGGCCTCCCTGAGCTTACAATATAAAAGGGGGACAGAGAGGTGAAGGTCTACACATCAGGGGCTTGCTCTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGC 0 false Homo sapiens OREG0002481 3659 IRF1 NCBI TRANSCRIPTION FACTOR BINDING SITE 30-Nov-2006 cell line: RPMI 8226 To study the contribution of Stat to the IFN-{alpha} action, we performed gel-shift analysis with the Stat motif using nuclear extracts from IFN-{alpha}-stimulated cells. IFN-{alpha} did, in fact, lead to a strong induction of a Stat binding protein (Fig. 5A, arrowhead). The specificity of this band has been demonstrated previously (10). There was a clear signal after 1 h of stimulation, sometimes with a decrease in binding activity at 2 h, as in this example. Later, the signal was strong again (Fig. 5A). 30-Nov-2006 OREGEC00001 OREGES00001 OREGET00001 dvlieghe cell line: RPMI 8226 To identify the proteins bound to the Stat3 motif after IFN-{alpha} stimulation by supershift analysis, the gels were again run for a longer period of time for better resolution of the bands (Fig. 5B). Here, anti-Stat1 Ab removed a minor high mobility band, while anti-Stat3 ablated the major low mobility band (lanes 3 and 5, respectively, in Fig. 5B). The combination of the Abs against Stat1 and Stat3 removed the entire specific complex (Fig. 5B, lane 6). The anti-Stat3 Ab induced the appearance of two supershifted bands (Fig. 5B, open arrows, lanes 5 and 6), while the anti-Stat1 Ab did not result in a visible band in the upper part of the gel. All other anti-Stat-Abs had no effect. These data suggest that the IFN-{alpha}-induced complex, which binds to the Stat3 motif, consists mainly of Stat3 homodimers (strong low mobility band) plus a small amount of Stat1 homodimers (weak higher mobility band). 30-Nov-2006 OREGEC00001 OREGES00002 OREGET00001 dvlieghe We then analyzed the effect of IFN-{alpha} on the human IL-10 promoter by studying a luciferase reporter construct with the -195 bp IL-10 promoter, which contains both the Stat and the IRF motif. IFN-{alpha} stimulation of RPMI 8226 cells transfected with this construct led to an average 5-fold trans-activation (Fig. 4, left panel, {blacksquare}) comparable to what was observed with LPS stimulation (). The combination of both stimuli did not lead to a further increase (). When we mutated the Stat motif, the LPS-induced trans-activation was markedly reduced, but surprisingly the IFN-{alpha} activity was completely ablated (Fig. 4, third panel). Mutation of both sites resulted in a loss of trans-activation by any of the stimuli (Fig. 4, fourth panel). 30-Nov-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe We then analyzed the effect of IFN-{alpha} on the human IL-10 promoter by studying a luciferase reporter construct with the -195 bp IL-10 promoter, which contains both the Stat and the IRF motif. IFN-{alpha} stimulation of RPMI 8226 cells transfected with this construct led to an average 5-fold trans-activation (Fig. 4, left panel, {blacksquare}) comparable to what was observed with LPS stimulation (). The combination of both stimuli did not lead to a further increase (). When we mutated the Stat motif, the LPS-induced trans-activation was markedly reduced, but surprisingly the IFN-{alpha} activity was completely ablated (Fig. 4, third panel). Mutation of both sites resulted in a loss of trans-activation by any of the stimuli (Fig. 4, fourth panel). 30-Nov-2006 OREGEC00000 OREGES00055 OREGET00009 dvlieghe 3586 IL10 NCBI 4189 POSITIVE OUTCOME 12817009 0 search_space GCTTACGATGCAAAAATTGAAAACTAAGTTTATTAGAGAGGTTAGAGAAGGAGGAGCTCTAAGGAGAAAAAATCCTGTGCCGGGAAACCTTGATTGTGGCTTTTTAATGAATGAAGAGGCCTCCCTGAGCTTACAATATAAAAGGGGGACAGAGAGGTGAAGGTCTACACATCAGGGGCTTGCTCTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGC 0 false 0 sequence TGCCGGGAA 0 false 0 sequence_with_flank GCTTACGATGCAAAAATTGAAAACTAAGTTTATTAGAGAGGTTAGAGAAGGAGGAGCTCTAAGGAGAAAAAATCCTGTGCCGGGAAACCTTGATTGTGGCTTTTTAATGAATGAAGAGGCCTCCCTGAGCTTACAATATAAAAGGGGGACAGAGAGGTGAAGGTCTACACATCAGGGGCTTGCTCTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGC 0 false Homo sapiens OREG0002517 6774 STAT3 NCBI TRANSCRIPTION FACTOR BINDING SITE These data demonstrate that Stat1 is able to counteract Stat3-mediated trans-activation of the human IL-10 promoter. 30-Nov-2006 dvlieghe 30-Nov-2006 10-May-2007 OREG0003113 obig To study the contribution of Stat to the IFN-{alpha} action, we performed gel-shift analysis with the Stat motif using nuclear extracts from IFN-{alpha}-stimulated cells. IFN-{alpha} did, in fact, lead to a strong induction of a Stat binding protein (Fig. 5A, arrowhead). The specificity of this band has been demonstrated previously (10). There was a clear signal after 1 h of stimulation, sometimes with a decrease in binding activity at 2 h, as in this example. Later, the signal was strong again (Fig. 5A). To identify the proteins bound to the Stat3 motif after IFN-{alpha} stimulation by supershift analysis, the gels were again run for a longer period of time for better resolution of the bands (Fig. 5B). Here, anti-Stat1 Ab removed a minor high mobility band, while anti-Stat3 ablated the major low mobility band (lanes 3 and 5, respectively, in Fig. 5B). The combination of the Abs against Stat1 and Stat3 removed the entire specific complex (Fig. 5B, lane 6). The anti-Stat3 Ab induced the appearance of two supershifted bands (Fig. 5B, open arrows, lanes 5 and 6), while the anti-Stat1 Ab did not result in a visible band in the upper part of the gel. All other anti-Stat-Abs had no effect. These data suggest that the IFN-{alpha}-induced complex, which binds to the Stat3 motif, consists mainly of Stat3 homodimers (strong low mobility band) plus a small amount of Stat1 homodimers (weak higher mobility band). In gel-shift analysis using the Stat motif we observed induction of a minor band that was identified as Stat1 (see Fig. 5). 30-Nov-2006 OREGEC00001 OREGES00001 OREGET00001 dvlieghe To study the contribution of Stat to the IFN-{alpha} action, we performed gel-shift analysis with the Stat motif using nuclear extracts from IFN-{alpha}-stimulated cells. IFN-{alpha} did, in fact, lead to a strong induction of a Stat binding protein (Fig. 5A, arrowhead). The specificity of this band has been demonstrated previously (10). There was a clear signal after 1 h of stimulation, sometimes with a decrease in binding activity at 2 h, as in this example. Later, the signal was strong again (Fig. 5A). To identify the proteins bound to the Stat3 motif after IFN-{alpha} stimulation by supershift analysis, the gels were again run for a longer period of time for better resolution of the bands (Fig. 5B). Here, anti-Stat1 Ab removed a minor high mobility band, while anti-Stat3 ablated the major low mobility band (lanes 3 and 5, respectively, in Fig. 5B). The combination of the Abs against Stat1 and Stat3 removed the entire specific complex (Fig. 5B, lane 6). The anti-Stat3 Ab induced the appearance of two supershifted bands (Fig. 5B, open arrows, lanes 5 and 6), while the anti-Stat1 Ab did not result in a visible band in the upper part of the gel. All other anti-Stat-Abs had no effect. These data suggest that the IFN-{alpha}-induced complex, which binds to the Stat3 motif, consists mainly of Stat3 homodimers (strong low mobility band) plus a small amount of Stat1 homodimers (weak higher mobility band). In gel-shift analysis using the Stat motif we observed induction of a minor band that was identified as Stat1 (see Fig. 5) 30-Nov-2006 OREGEC00001 OREGES00002 OREGET00001 dvlieghe 30-Nov-2006 OREGEC00001 OREGES00004 OREGET00002 dvlieghe When we mutated the Stat motif, the LPS-induced trans-activation was markedly reduced, but surprisingly the IFN-{alpha} activity was completely ablated (Fig. 4, third panel). Mutation of both sites resulted in a loss of trans-activation by any of the stimuli (Fig. 4, fourth panel). 30-Nov-2006 OREGEC00001 OREGES00055 OREGET00009 dvlieghe ENSG00000136634 IL10 ENSEMBL homo_sapiens_core_41_36c 4199 POSITIVE OUTCOME 12817009 0 search_space GCTTACGATGCAAAAATTGAAAACTAAGTTTATTAGAGAGGTTAGAGAAGGAGGAGCTCTAAGGAGAAAAAATCCTGTGCCGGGAAACCTTGATTGTGGCTTTTTAATGAATGAAGAGGCCTCCCTGAGCTTACAATATAAAAGGGGGACAGAGAGGTGAAGGTCTACACATCAGGGGCTTGCTCTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGC 0 false 0 sequence TGCCGGGAA 0 false 0 sequence_with_flank GCTTACGATGCAAAAATTGAAAACTAAGTTTATTAGAGAGGTTAGAGAAGGAGGAGCTCTAAGGAGAAAAAATCCTGTGCCGGGAAACCTTGATTGTGGCTTTTTAATGAATGAAGAGGCCTCCCTGAGCTTACAATATAAAAGGGGGACAGAGAGGTGAAGGTCTACACATCAGGGGCTTGCTCTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGC 0 false Homo sapiens OREG0002535 ENSG00000115415 STAT1 ENSEMBL homo_sapiens_core_41_36c TRANSCRIPTION FACTOR BINDING SITE Homo sapiens 9606 Ciona intestinalis 7719 dvlieghe