16-Aug-2005 25-Oct-2005 OREG0001748 mzhang 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer D1009.5 xbx-2 ENSEMBL caenorhabditis_elegans_core_32_140a 46 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCCATGACAAC 0 false 0 sequence_with_flank tgcctctaggcaacagcttaGTTGCCATGACAACgcgttgccaaggtgaattgg 0 false Caenorhabditis elegans OREG0000045 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 25-Oct-2005 OREG0001749 mzhang 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer M04D8.6 xbx-3 ENSEMBL caenorhabditis_elegans_core_32_140a 47 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGTCTTGGCAAC 0 false 0 sequence_with_flank ttttagacagagccgtgtgtGTTGTCTTGGCAACagtcagaatctcgtgctcgc 0 false Caenorhabditis elegans OREG0000046 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 25-Oct-2005 OREG0001750 mzhang Mutation assay of some kind. Those genes cause abnormalities in specific ciliary functions (e.g. Odr, but not Dyf phenotype). 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer C23H5.3 xbx-4 ENSEMBL caenorhabditis_elegans_core_32_140a 48 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCCATGACAAC 0 false 0 sequence_with_flank actacacctgcctcccactaGTTGCCATGACAACcgcgctccactgagaaatgc 0 false Caenorhabditis elegans OREG0000047 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 25-Oct-2005 OREG0001755 mzhang 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer T24A11.2 xbx-5 ENSEMBL caenorhabditis_elegans_core_32_140a 49 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTCTCCATGACAAC 0 false 0 sequence_with_flank gcggctccgttggctccgacGTCTCCATGACAACaatgtatccagccgcataat 0 false Caenorhabditis elegans OREG0000048 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 25-Oct-2005 OREG0001756 mzhang 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer R148.1 xbx-7 ENSEMBL caenorhabditis_elegans_core_32_140a 50 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTCACCATAGGAAC 0 false 0 sequence_with_flank ttccctatgcccccccccccGTCACCATAGGAACcctcctccggagggcgaggt 0 false Caenorhabditis elegans OREG0000049 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 25-Oct-2005 OREG0001757 mzhang Mutation assay of some kind. Those genes cause abnormalities in general ciliary structure and function (e.g. Dyf+sensory phenotypes). 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer C27A7.4 che-11 ENSEMBL caenorhabditis_elegans_core_32_140a 51 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence ATCTCCATGGCAAC 0 false 0 sequence_with_flank aaggggagatgcgtgttttgATCTCCATGGCAACtttgctcgcgggggaaggcg 0 false Caenorhabditis elegans OREG0000050 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 25-Oct-2005 OREG0001758 mzhang Mutation assay of some kind. Those genes cause abnormalities in specific ciliary functions (e.g. Odr, but not Dyf phenotype). 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer F10B5.4 tub-1 ENSEMBL caenorhabditis_elegans_core_32_140a 52 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence ATCTCCATGACAAC 0 false 0 sequence_with_flank tgagagagcattggctccacATCTCCATGACAACtttgtgagagaaggcgaaga 0 false Caenorhabditis elegans OREG0000051 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 25-Oct-2005 OREG0001759 mzhang 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 msleumer T19A5.4 nhr-44 ENSEMBL caenorhabditis_elegans_core_32_140a 53 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTCTTCATGGCAAC 0 false 0 sequence_with_flank aaagtcgtgtgagaatggagGTCTTCATGGCAACcgacaccttggttaccaaca 0 false Caenorhabditis elegans OREG0000052 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer T05E11.3 T05E11.3 ENSEMBL caenorhabditis_elegans_core_33_140a 1970 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence GCAAACA 0 false 0 sequence_with_flank gtgagccccggcgaaagaaaGCAAACAagcggagagaaaaggggagt 0 false Caenorhabditis elegans OREG0001734 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer D2096.6 D2096.6 ENSEMBL caenorhabditis_elegans_core_33_140a 1971 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence ACAAACA 0 false 0 sequence_with_flank gagcacaacgaaatctttctACAAACAcgtccacttccccccatcgc 0 false Caenorhabditis elegans OREG0001735 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer C44H4.1 C44H4.1 ENSEMBL caenorhabditis_elegans_core_33_140a 1972 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence GTCAATA 0 false 0 sequence_with_flank ttggtggtctcgaggtatttGTCAATActtttccttgttgtcgtgat 0 false Caenorhabditis elegans OREG0001736 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer C44H4.1 C44H4.1 ENSEMBL caenorhabditis_elegans_core_33_140a 1973 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence TATTTGT 0 false 0 sequence_with_flank ttattttggtggtctcgaggTATTTGTcaatacttttccttgttgtc 0 false Caenorhabditis elegans OREG0001737 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer ZK816.4 ZK816.4 ENSEMBL caenorhabditis_elegans_core_33_140a 1974 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence ACAAACA 0 false 0 sequence_with_flank atgattgcgcgctccaagaaACAAACAtaagcaaagtgcataacccg 0 false Caenorhabditis elegans OREG0001738 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer F29F11.5 ceh-22 ENSEMBL caenorhabditis_elegans_core_33_140a 1975 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence TATTTGT 0 false 0 sequence_with_flank aagtttttacataatctataTATTTGTcttgatggaaatatttaagt 0 false Caenorhabditis elegans OREG0001739 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer F29F11.5 ceh-22 ENSEMBL caenorhabditis_elegans_core_33_140a 1976 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence ACGTGTGCAAAAAGATAGAATTTGATCTATTATGGAAAGTTATGTATTAAGATATCGACTTTGGTACCTAATCGATTATTGTTATTAATTTGTGAAAGGAGCCTTGATGAGATTTATCTTTAACCATTAATTGCATACAATGACCACTAATTCAAATCTATTCCGCAATTGGGTCCTTGTCTTTATAAAGAATGCCAAAATGTTGTACTGGTTTCAAAAGTAAGTAGGCATAGTTTCAAGTGTAATA 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0001740 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION The real sequence is found in the ZK1290.2a unspliced transcript sequence. 18-Oct-2005 msleumer 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer ZK1290.2 tph-1 ENSEMBL caenorhabditis_elegans_core_33_140a 1977 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence ATCAACA 0 false 0 sequence_with_flank tgcgcataataaaacaatcaATCAACAcagcaaagacccctctcaac 0 false Caenorhabditis elegans OREG0001741 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The real sequence is found in the ZK1290.2a unspliced transcript sequence. 18-Oct-2005 msleumer 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer ZK1290.2 tph-1 ENSEMBL caenorhabditis_elegans_core_33_140a 1978 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence TGTTTGC 0 false 0 sequence_with_flank tctaaaagaggaggtgtcttTGTTTGCgcataataaaacaatcaatc 0 false Caenorhabditis elegans OREG0001742 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer M05B5.2 M05B5.2 ENSEMBL caenorhabditis_elegans_core_33_140a 1979 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence TGTTGAC 0 false 0 sequence_with_flank taaccccgttatgttctctaTGTTGACtcttcactgactcatacgca 0 false Caenorhabditis elegans OREG0001743 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer T18D3.4 myo-2 ENSEMBL caenorhabditis_elegans_core_33_140a 1980 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence TGTTTGC 0 false 0 sequence_with_flank tctggataaaattctctcgtTGTTTGCcgtcggatgtctgcctctct 0 false Caenorhabditis elegans OREG0001744 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The real sequence is found in the R11G10.1b.1 unspliced transcript sequence. 18-Oct-2005 msleumer 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer R11G10.1 avr-15 ENSEMBL caenorhabditis_elegans_core_33_140a 1981 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence ATGTCTACCTCATTTATCAGAAGACTGGCCTTCGTAGGCTTACTTCTAGGAGTACATGCCTATCATTCTAGGTACTGTATACTTATATTTGTATTTAGTTTCTTTCAATTAAAATGTTCAGGTCAAAAGCGTACAAGTTGTCATGATAAACAAAAAGTAATTTGAGAATGTTTGCAGATCAAACAGTAGCGTAAAAACTTTAAACTTTAAAATTGCCAACAAAAAAAACCACACCACCCACTTGAAAACTCAAGT 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0001745 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION The real sequence is found in the T14F9.4a unspliced transcript sequence. 18-Oct-2005 msleumer 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer T14F9.4 peb-1 ENSEMBL caenorhabditis_elegans_core_33_140a 1982 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence ATGCTGGGTCTTGAAAAGCCTGGATCATCAGACATTTCGTCTTCTTCCACTGATACTTCCGCCATTTCTCCGATTAGCGTGAGCAGTATGCCACTATCACCGGACAAGGAAAAGAAAAAGGTAAGTACTTTGAGATAACTGTTTGGACTGTCCGAAGGGCAAACATAGTTTTGAAAGAGAACGTTTGCATAGTTGACCGGTGTTTGTTCAGACGGAAAATTTAGGGCTTCCTTCCCACACGAATTTCAAAACAAC 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0001746 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION The real sequence is found in the H30A04.1a unspliced transcript sequence. 18-Oct-2005 msleumer 18-Oct-2005 Electrophoretic mobility shift assay (EMSA); Gel shift competition; In-vivo GFP Expression Assay 18-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer H30A04.1 eat-20 ENSEMBL caenorhabditis_elegans_core_33_140a 1983 POSITIVE OUTCOME 11823633 0 search_space EMPTY 0 false 0 sequence GTAGGTTTTTTTCTGTAAAATTCATAAATTCTCAAATTCTCCCATTCTCTCGCACACACAACTTACATGCCAAGGTCAATGTTGACACTAATCTCAGAAGCGCTGTGCCTCTCGTTTTCGAAAAATTTGCGGTCCGATACCATGATATTTGCATTGAGCACAAAAACACACACAAATATGTTTTTGTGGATCTCCCCCCTCTTTGAAAAATGTTTTGTTGTTCGTCAAGTGGATCTTTCCAAAACGACTCGACCT 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0001747 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION This binding sequence is named the Ex-1 cis-regulatory element in the article. 26-Oct-2005 msleumer 26-Oct-2005 Reporter gene assay; Yeast 1-hybrid assay; Electrophoretic mobility shift assay (Direct gel shift) 26-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer Reporter gene assay; Yeast 1-hybrid assay; Electrophoretic mobility shift assay (Direct gel shift) 26-Oct-2005 OREGEC00002 OREGES00022 OREGET00003 msleumer Reporter gene assay; Yeast 1-hybrid assay; Electrophoretic mobility shift assay (Direct gel shift) 26-Oct-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer Reporter gene assay; Yeast 1-hybrid assay; Electrophoretic mobility shift assay (Direct gel shift) 26-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer Reporter gene assay; Yeast 1-hybrid assay; Electrophoretic mobility shift assay (Direct gel shift) 26-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Reporter gene assay; Yeast 1-hybrid assay; Electrophoretic mobility shift assay (Direct gel shift) 26-Oct-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F22E10.1 pgp-12 ENSEMBL caenorhabditis_elegans_core_33_140a 2753 POSITIVE OUTCOME 16159881 0 search_space EMPTY 0 false 0 sequence CCATACATTA 0 false 0 sequence_with_flank tcaacctgtacaaaggatttCCATACATTAttcccgcgtttttggcaccc 0 false Caenorhabditis elegans OREG0004194 C26C6.5 DCP-66 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This binding sequence is named the Ex-1 cis-regulatory element in the article. 26-Oct-2005 msleumer 26-Oct-2005 Orthologous gene conservation; Co-expressed gene conservation 26-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Orthologous gene conservation; Co-expressed gene conservation 26-Oct-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer CBG00086 CBG00086 USER DEFINED Cb25 2754 POSITIVE OUTCOME 16159881 0 search_space EMPTY 0 false 0 sequence CCATACATTA 0 false 0 sequence_with_flank cattatttcgaaagtgatttCCATACATTAttaccgacgatttttttttc 0 false Caenorhabditis briggsae OREG0004195 C26C6.5 DCP-66 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This binding sequence is named the Ex-2 cis-regulatory element in the article. 26-Oct-2005 msleumer 26-Oct-2005 Orthologous gene conservation; Co-expressed gene conservation 26-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Orthologous gene conservation; Co-expressed gene conservation 26-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer ZK455.7 pgp-3 ENSEMBL caenorhabditis_elegans_core_33_140a 2755 POSITIVE OUTCOME 16159881 0 search_space EMPTY 0 false 0 sequence CTCACAAAATATAAATATGGTAATTC 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0004196 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION This binding sequence is named the Ex-3 cis-regulatory element in the article. 26-Oct-2005 msleumer 26-Oct-2005 Orthologous gene conservation; Co-expressed gene conservation 26-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Orthologous gene conservation; Co-expressed gene conservation 26-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer F58B4.1 nas-31 ENSEMBL caenorhabditis_elegans_core_33_140a 2756 POSITIVE OUTCOME 16159881 0 search_space EMPTY 0 false 0 sequence GTTTCGAAAGTTCATCACCCCCAAC 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0004197 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION The C.briggsae gene is the putative ortholog of C.elegans gene F38G1.1. 20-Oct-2005 msleumer 20-Oct-2005 site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00002 OREGES00028 OREGET00010 msleumer CBG13647 CBG13647 USER DEFINED Cb25 2757 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTATCCATGGCAAC 0 false 0 sequence_with_flank gcgtctccagctgctattagGTATCCATGGCAACcaaaaattccgcccgtttct 0 false Caenorhabditis briggsae OREG0004198 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene F59C6.7. 20-Oct-2005 msleumer 20-Oct-2005 30-Nov-2005 OREG0001853 mzhang CBG02227 CBG02227 USER DEFINED Cb25 2758 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTTCCTTGACAAC 0 false 0 sequence_with_flank caaccccgtttgcgagagacGTTTCCTTGACAACcgaggaaacacacttccgct 0 false Caenorhabditis briggsae OREG0004199 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene T27B1.1. 20-Oct-2005 msleumer 20-Oct-2005 site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00002 OREGES00028 OREGET00010 msleumer CBG16355 CBG16355 USER DEFINED Cb25 2759 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCCATGGACAC 0 false 0 sequence_with_flank cacacggggtgttttattcgGTTGCCATGGACACatttcccaaacgagactccc 0 false Caenorhabditis briggsae OREG0004200 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene Y41G9A.1. 20-Oct-2005 msleumer 20-Oct-2005 site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00002 OREGES00028 OREGET00010 msleumer CBG02013 CBG02013 USER DEFINED Cb25 2760 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCCAGGGAAAC 0 false 0 sequence_with_flank ttctctcggcgcgtctttcgGTTGCCAGGGAAACgcaacgcttgttttccctgg 0 false Caenorhabditis briggsae OREG0004201 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene Y105E8A.5. 20-Oct-2005 msleumer 20-Oct-2005 30-Nov-2005 OREG0001854 mzhang CBG08744 CBG08744 USER DEFINED Cb25 2761 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGTTATGGTAAC 0 false 0 sequence_with_flank aagaacaagaaggagacttgGTTGTTATGGTAACctcctcacgcatatgtgccc 0 false Caenorhabditis briggsae OREG0004202 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene F20D12.3. 20-Oct-2005 msleumer 20-Oct-2005 site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00002 OREGES00028 OREGET00010 msleumer CBG17712 CBG17712 USER DEFINED Cb25 2762 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence ATATCCATGGCAAC 0 false 0 sequence_with_flank ctctctttcctcttcctccgATATCCATGGCAACggagccaacacaagcttctc 0 false Caenorhabditis briggsae OREG0004203 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene R01H10.6. 20-Oct-2005 msleumer 20-Oct-2005 17-Apr-2007 OREG0002999 obig CBG23799 CBG23799 USER DEFINED Cb25 2763 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTACTATGGCAAC 0 false 0 sequence_with_flank tgctgtcgagtttacaccttGTTACTATGGCAACctgacacactcacgcgcctc 0 false Caenorhabditis briggsae OREG0004204 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene Y75B8A.12. 20-Oct-2005 msleumer 20-Oct-2005 CBG23043 CBG23043 USER DEFINED Cb25 2764 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCCATGGTTAC 0 false 0 sequence_with_flank cacctgacctcctccccttgGTTGCCATGGTTACcaaacgcgccccgccggaca 0 false Caenorhabditis briggsae OREG0004205 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene T25F10.5. 20-Oct-2005 msleumer 20-Oct-2005 CBG19013 CBG19013 USER DEFINED Cb25 2765 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTCTCTATGGCAAC 0 false 0 sequence_with_flank atactccaagtgtgcaattcGTCTCTATGGCAACctgagctccacgacgtctgc 0 false Caenorhabditis briggsae OREG0004206 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene F02D8.3. 20-Oct-2005 msleumer 20-Oct-2005 site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00002 OREGES00028 OREGET00010 msleumer CBG11597 CBG11597 USER DEFINED Cb25 2766 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTTCCATGGTTAC 0 false 0 sequence_with_flank ataaatcttgttgaattcttGTTTCCATGGTTACctcgtttcccccttctggtg 0 false Caenorhabditis briggsae OREG0004207 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene D1009.5. 20-Oct-2005 msleumer 20-Oct-2005 site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00002 OREGES00028 OREGET00010 msleumer CBG00241 CBG00241 USER DEFINED Cb25 2767 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTTCCATGGCTAC 0 false 0 sequence_with_flank atcgattcacctgcgtccttGTTTCCATGGCTACagagcggtgaggcgtgcgtg 0 false Caenorhabditis briggsae OREG0004208 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene M04D8.6. 20-Oct-2005 msleumer 20-Oct-2005 CBG09908 CBG09908 USER DEFINED Cb25 2768 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTTCCAAGGAGAC 0 false 0 sequence_with_flank agtgtttccatttcactcacGTTTCCAAGGAGACatcagcagggaggaaaactc 0 false Caenorhabditis briggsae OREG0004209 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene C23H5.3. 20-Oct-2005 msleumer 20-Oct-2005 CBG10549 CBG10549 USER DEFINED Cb25 2769 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCCCTGGTGAC 0 false 0 sequence_with_flank cctttttctcacgtcttctaGTTGCCCTGGTGACgtccactttcatcgattttc 0 false Caenorhabditis briggsae OREG0004210 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene T24A11.2. 20-Oct-2005 msleumer 20-Oct-2005 CBG09228 CBG09228 USER DEFINED Cb25 2770 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTCTCCATGGCAAC 0 false 0 sequence_with_flank ttgtggcagagacactagcaGTCTCCATGGCAACatgaatctcatgattggagc 0 false Caenorhabditis briggsae OREG0004211 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene F40F9.1. 20-Oct-2005 msleumer 20-Oct-2005 CBG19349 CBG19349 USER DEFINED Cb25 2771 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTATCCATGGAAAC 0 false 0 sequence_with_flank gtcggtgagcacgagtcggcGTATCCATGGAAACtaaacgcatgtgataaacaa 0 false Caenorhabditis briggsae OREG0004212 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene C27A7.4. 20-Oct-2005 msleumer 20-Oct-2005 CBG23392 CBG23392 USER DEFINED Cb25 2772 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTATCCATAGCAAC 0 false 0 sequence_with_flank aatccataacgagagcgaggGTATCCATAGCAACacggaacgcatgctgacttc 0 false Caenorhabditis briggsae OREG0004213 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene Y102E9.1. 20-Oct-2005 msleumer 20-Oct-2005 site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer site KO, TF KO; Orthologous gene conservation 20-Oct-2005 OREGEC00002 OREGES00028 OREGET00010 msleumer CBG16563 CBG16563 USER DEFINED Cb25 2773 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence ATCGCCATGGTTAC 0 false 0 sequence_with_flank ctctcttttcttgagtattcATCGCCATGGTTACtctttttcttgtttgctcgg 0 false Caenorhabditis briggsae OREG0004214 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The C.briggsae gene is the putative ortholog of C.elegans gene F10B5.4. 20-Oct-2005 msleumer 20-Oct-2005 CBG00741 CBG00741 USER DEFINED Cb25 2774 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence ATCACCATGGCAAC 0 false 0 sequence_with_flank tctccagttttccacatccaATCACCATGGCAACgtccgcgcgcgcgtgcgctc 0 false Caenorhabditis briggsae OREG0004215 F33H1.1 DAF-19 ENSEMBL caenorhabditis_briggsae_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE1 site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer Y46H3A.3 Hsp-16-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2775 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCTAGAA 0 false 0 sequence_with_flank ttctgcagccttacagaatgTTCTAGAAggtcctagatgcattcgttt 0 false Caenorhabditis elegans OREG0004216 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSAS site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer Y46H3A.3 Hsp-16-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2776 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence GGGTCTC 0 false 0 sequence_with_flank cgcagacggaaaatgtatctGGGTCTCtttattgtgtacactacttt 0 false Caenorhabditis elegans OREG0004217 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE2 site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 22-Nov-2005 OREG0001809 mzhang Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer Y46H3A.3 Hsp-16-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2777 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCTAGAA 0 false 0 sequence_with_flank ttctgcagccttacagaatgTTCTAGAAggtcctagatgcattcgttt 0 false Caenorhabditis elegans OREG0004218 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSAS site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 28-Aug-2006 OREG0002344 bchu Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2778 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence GGGTGAC 0 false 0 sequence_with_flank gaacttttagtttcttctgaGGGTGACatactacccgaatcccagcc 0 false Caenorhabditis elegans OREG0004219 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2779 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCTAGAA 0 false 0 sequence_with_flank tatacctttcccgtaacttcTTCTAGAAgcttctggaatattccactg 0 false Caenorhabditis elegans OREG0004220 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2780 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCTGGAA 0 false 0 sequence_with_flank ccgtaacttcttctagaagcTTCTGGAAtattccactgcaccagctgc 0 false Caenorhabditis elegans OREG0004221 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2781 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCGAGAA 0 false 0 sequence_with_flank ttctttctgctgcccagccaTTCGAGAAcgttctagaaccttccatta 0 false Caenorhabditis elegans OREG0004222 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2782 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCTAGAA 0 false 0 sequence_with_flank tgcccagccattcgagaacgTTCTAGAAccttccattataagagaaag 0 false Caenorhabditis elegans OREG0004223 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2783 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCGAGAA 0 false 0 sequence_with_flank ttgttggaggaaatggaatgTTCGAGAAaaagaaagagggagacagag 0 false Caenorhabditis elegans OREG0004224 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2784 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCCAGAA 0 false 0 sequence_with_flank gcagctggtgcagtggaataTTCCAGAAgcttctagaagatgttacgg 0 false Caenorhabditis elegans OREG0004225 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSE site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2785 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence TTCTAGAA 0 false 0 sequence_with_flank cagtggaatattccagaagcTTCTAGAAgatgttacgggaaaggtata 0 false Caenorhabditis elegans OREG0004226 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE This binding site is named HSAS site in this paper. 9-Nov-2005 msleumer 8-Nov-2005 28-Aug-2006 OREG0002346 bchu Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation; Orthologous gene conservation 8-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F44E5.5 F44E5.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2786 POSITIVE OUTCOME 11997337 0 search_space EMPTY 0 false 0 sequence GTCACCC 0 false 0 sequence_with_flank ggctgggattcgggtagtatGTCACCCtcagaagaaactaaaagttc 0 false Caenorhabditis elegans OREG0004227 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 4-Nov-2005 Y37E3.5 Y37E3.5 ENSEMBL caenorhabditis_elegans_core_33_140a 2787 POSITIVE OUTCOME 15314642 0 search_space EMPTY 0 false 0 sequence GTAACTATGGCAAC 0 false 0 sequence_with_flank ttgtgctctctcgggctctgGTAACTATGGCAACcgccgctcgtgaaagccgag 0 false Caenorhabditis elegans OREG0004228 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 4-Nov-2005 C38D4.8 Arl-6 ENSEMBL caenorhabditis_elegans_core_33_140a 2788 POSITIVE OUTCOME 15314642 0 search_space EMPTY 0 false 0 sequence GTTTCCATGGTTAC 0 false 0 sequence_with_flank gaccacctgcttgtttgcttGTTTCCATGGTTACctgcttgagatgcaaagcga 0 false Caenorhabditis elegans OREG0004229 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer C23H3.9a C23H3.9a ENSEMBL caenorhabditis_elegans_core_33_140a 2789 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TATTTGT 0 false 0 sequence_with_flank cacacaaaaatcttatttaaTATTTGTgtgcacacatttaatctaac 0 false Caenorhabditis elegans OREG0004230 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer E01G6.1 E01G6.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2790 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TATTTGT 0 false 0 sequence_with_flank ttgaattcaaaaaaatcaaaTATTTGTtgtagactttctttttacgc 0 false Caenorhabditis elegans OREG0004231 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F08B12.4 F08B12.4 ENSEMBL caenorhabditis_elegans_core_33_140a 2791 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACAAACA 0 false 0 sequence_with_flank ttcatcggctcgtttacttcACAAACAatttttcgtttgctcttcgc 0 false Caenorhabditis elegans OREG0004232 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F53B3.3 F53B3.3 ENSEMBL caenorhabditis_elegans_core_33_140a 2792 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTTGC 0 false 0 sequence_with_flank caagccttcatcggaggtacTGTTTGCtttcaactggcacacacaca 0 false Caenorhabditis elegans OREG0004233 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F54E2.3 ketn-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2793 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GTAAACA 0 false 0 sequence_with_flank ttccaggtgcatgtttggtcGTAAACAatagattacaatctacagaa 0 false Caenorhabditis elegans OREG0004234 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T03F1.11 T03F1.11 ENSEMBL caenorhabditis_elegans_core_33_140a 2794 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACAAACA 0 false 0 sequence_with_flank atcgtcaatgtttgacacttACAAACAacgactttcgaaaattcaaa 0 false Caenorhabditis elegans OREG0004235 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T05B4.11 T05B4.11 ENSEMBL caenorhabditis_elegans_core_33_140a 2795 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ATCAATA 0 false 0 sequence_with_flank cctagcaccctctcaacaccATCAATActattttcacaccacacaag 0 false Caenorhabditis elegans OREG0004236 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T25E4.1 T25E4.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2796 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACAAATA 0 false 0 sequence_with_flank taaaagtgaaatgaatggcaACAAATActcatcaagcttctcgcttt 0 false Caenorhabditis elegans OREG0004237 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer ZK1067.7 pqn-95 ENSEMBL caenorhabditis_elegans_core_33_140a 2797 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACAAATA 0 false 0 sequence_with_flank atataatttaccaaagctgaACAAATAatccactcatttggtgaata 0 false Caenorhabditis elegans OREG0004238 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer R07B1.9 R07B1.9 ENSEMBL caenorhabditis_elegans_core_33_140a 2798 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTGAT 0 false 0 sequence_with_flank gctgttgtgttgcatattttTGTTGATctatctcacctactgtgttt 0 false Caenorhabditis elegans OREG0004239 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer R07B1.9 R07B1.9 ENSEMBL caenorhabditis_elegans_core_33_140a 2799 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTTGC 0 false 0 sequence_with_flank ttgatctatctcacctactgTGTTTGCtcgacgagctctcacccttc 0 false Caenorhabditis elegans OREG0004240 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer B0507.1 B0507.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2800 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTGAC 0 false 0 sequence_with_flank atacataaaaatgtacatgtTGTTGACacgattgaagacagtgacca 0 false Caenorhabditis elegans OREG0004241 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer C14C11.8 pqn-13 ENSEMBL caenorhabditis_elegans_core_33_140a 2801 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GCAAATA 0 false 0 sequence_with_flank atactgtccagctccaagcaGCAAATAagcacacacccgcacaatgt 0 false Caenorhabditis elegans OREG0004242 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F08B12.1 F08B12.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2802 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ATCAACA 0 false 0 sequence_with_flank ttgctacctcattgtttcatATCAACActacgcgacgccctttttac 0 false Caenorhabditis elegans OREG0004243 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F11E6.8 F11E6.8 ENSEMBL caenorhabditis_elegans_core_33_140a 2803 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TATTTGC 0 false 0 sequence_with_flank caccctttacgtgttattatTATTTGCtaaaattaaaaataatcaat 0 false Caenorhabditis elegans OREG0004244 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F26A10.2 F26A10.2 ENSEMBL caenorhabditis_elegans_core_33_140a 2804 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTGAT 0 false 0 sequence_with_flank cagacatttgaaacccatatTGTTGATtttcaactggtcatttcttg 0 false Caenorhabditis elegans OREG0004245 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F26F12.4 F26F12.4 ENSEMBL caenorhabditis_elegans_core_33_140a 2805 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TATTGAC 0 false 0 sequence_with_flank ctcccattgagcctcaccttTATTGACatgacgttttgacaactagt 0 false Caenorhabditis elegans OREG0004246 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a 2806 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTGAT 0 false 0 sequence_with_flank tcaccatcacactgtcacagTGTTGATaacgaagagtcgtatcaaga 0 false Caenorhabditis elegans OREG0004247 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a 2807 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GCCAATA 0 false 0 sequence_with_flank aacaaaatcacccaaccccaGCCAATAttaccttatacaccctatct 0 false Caenorhabditis elegans OREG0004248 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F41H10.8 elo-6 ENSEMBL caenorhabditis_elegans_core_33_140a 2808 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTTGC 0 false 0 sequence_with_flank tcgggctcttggagccaaaaTGTTTGCtttgttgtattcttatgtta 0 false Caenorhabditis elegans OREG0004249 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F48E3.8a F48E3.8a ENSEMBL caenorhabditis_elegans_core_33_140a 2809 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTTAT 0 false 0 sequence_with_flank catgcggttattgttcttagTGTTTATattagcaggtaaaaaaactg 0 false Caenorhabditis elegans OREG0004250 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F48E3.8a F48E3.8a ENSEMBL caenorhabditis_elegans_core_33_140a 2810 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACCAACA 0 false 0 sequence_with_flank ctcaagttctgtcttttgcaACCAACActtttcgttttcattttgag 0 false Caenorhabditis elegans OREG0004251 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F48E3.8a F48E3.8a ENSEMBL caenorhabditis_elegans_core_33_140a 2811 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTGGT 0 false 0 sequence_with_flank aatagaaactgtgtgtgcccTGTTGGTtttttggcaattcagcagac 0 false Caenorhabditis elegans OREG0004252 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer K07C11.4 K07C11.4 ENSEMBL caenorhabditis_elegans_core_33_140a 2812 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTTGC 0 false 0 sequence_with_flank tgcctgggctatctcatattTGTTTGCagcacaaataacttctccac 0 false Caenorhabditis elegans OREG0004253 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer K08F8.2 atf-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2813 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TATTTGT 0 false 0 sequence_with_flank aatttcaactcaaaaagacgTATTTGTccttacatcaaataggttga 0 false Caenorhabditis elegans OREG0004254 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer M03D4.4a M03D4.4a ENSEMBL caenorhabditis_elegans_core_33_140a 2814 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GCAAACA 0 false 0 sequence_with_flank atcctaatacaaatagtcacGCAAACAaaaaagaagcgttttttctc 0 false Caenorhabditis elegans OREG0004255 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer R02F11.1 R02F11.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2815 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACAAACA 0 false 0 sequence_with_flank tcaatcgtccacttcattttACAAACAcatagactggactgagcccg 0 false Caenorhabditis elegans OREG0004256 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T06D8.3 T06D8.3 ENSEMBL caenorhabditis_elegans_core_33_140a 2816 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGTTTAC 0 false 0 sequence_with_flank agcttcttctctacttgactTGTTTACccatcacgtacggtacgcag 0 false Caenorhabditis elegans OREG0000109 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE pha-4 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer W06F12.2a W06F12.2a ENSEMBL caenorhabditis_elegans_core_33_140a 2817 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACAAACA 0 false 0 sequence_with_flank acttgaaaaattaattagttACAAACActtaatatttttctcttgtt 0 false Caenorhabditis elegans OREG0001733 F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer C23H3.9a C23H3.9a ENSEMBL caenorhabditis_elegans_core_33_140a 2818 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TTTTTCC 0 false 0 sequence_with_flank aaaatttttggcaatggccgTTTTTCCggcggatttggcaatttgcc 0 false Caenorhabditis elegans OREG0001760 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer C23H3.9a C23H3.9a ENSEMBL caenorhabditis_elegans_core_33_140a 2819 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TTTTTCC 0 false 0 sequence_with_flank ccttttgcacagggcgcttcTTTTTCCgcgcggtaaggagctcgacg 0 false Caenorhabditis elegans OREG0001762 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer E01G6.1 E01G6.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2820 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TTTTTCC 0 false 0 sequence_with_flank atgatattttctcccagccgTTTTTCCaagcaccgggtaaattattc 0 false Caenorhabditis elegans OREG0001763 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer E01G6.1 E01G6.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2821 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence CTTTTCC 0 false 0 sequence_with_flank actttctttttacgctcaatCTTTTCCagtaatattccaatatgtat 0 false Caenorhabditis elegans OREG0001764 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F53B3.3 F53B3.3 ENSEMBL caenorhabditis_elegans_core_33_140a 2822 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence CTTTTCC 0 false 0 sequence_with_flank attcctaaccaccacttagcCTTTTCCctgcctcacccaactagact 0 false Caenorhabditis elegans OREG0001765 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T05B4.11 T05B4.11 ENSEMBL caenorhabditis_elegans_core_33_140a 2823 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GGAAAAA 0 false 0 sequence_with_flank ttgatgactcacaaaaaaagGGAAAAAagtaaaacatgaagcgaact 0 false Caenorhabditis elegans OREG0001766 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T05B4.11 T05B4.11 ENSEMBL caenorhabditis_elegans_core_33_140a 2824 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GGAAAAA 0 false 0 sequence_with_flank atggaaattagtataaaagaGGAAAAAataatggtgaaattcacagc 0 false Caenorhabditis elegans OREG0001767 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T05B4.3 T05B4.3 ENSEMBL caenorhabditis_elegans_core_33_140a 2825 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TTTTTCC 0 false 0 sequence_with_flank tatcacccccgccccattttTTTTTCCagcccagtgacgctttctga 0 false Caenorhabditis elegans OREG0001768 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T06E4.8 T06E4.8 ENSEMBL caenorhabditis_elegans_core_33_140a 2826 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TTTTTCC 0 false 0 sequence_with_flank acggcatgcaactttgtcgcTTTTTCCcaatgaatagggcggccgag 0 false Caenorhabditis elegans OREG0001769 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Late-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T25E4.1 T25E4.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2827 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GTTTTCC 0 false 0 sequence_with_flank cttcgaatcatcgtttgattGTTTTCCagtaaaaataagaaatgagt 0 false Caenorhabditis elegans OREG0001770 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Repressor (Late-1) 9-Nov-2005 msleumer 9-Nov-2005 In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer R07B1.9 R07B1.9 ENSEMBL caenorhabditis_elegans_core_33_140a 2828 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence CCTTGGCGGCTC 0 false 0 sequence_with_flank ccaccttctctcgtcccacaCCTTGGCGGCTCtctcaccatttttctctttg 0 false Caenorhabditis elegans OREG0001771 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-1 9-Nov-2005 msleumer 9-Nov-2005 In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer K07C11.4 K07C11.4 ENSEMBL caenorhabditis_elegans_core_33_140a 2829 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence CTGCGTCTCT 0 false 0 sequence_with_flank ataacttctccacctttcggCTGCGTCTCTtctataccgtcagtctctca 0 false Caenorhabditis elegans OREG0001772 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 22-Nov-2005 OREG0001812 mzhang In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer K07C11.4 K07C11.4 ENSEMBL caenorhabditis_elegans_core_33_140a 2830 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GAGGTCAAG 0 false 0 sequence_with_flank TtgcatatacctgccaaagaGAGGTCAAGccacttttttggagctgatg 0 false Caenorhabditis elegans OREG0001773 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer In-vivo GFP Expression Assay; Orthologous gene conservation; Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer K07C11.4 K07C11.4 ENSEMBL caenorhabditis_elegans_core_33_140a 2831 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TCTGACCCT 0 false 0 sequence_with_flank aacacaattatcaccacacaTCTGACCCTtctttaccttcccctaccat 0 false Caenorhabditis elegans OREG0001774 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F08B12.1 F08B12.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2832 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TCTGACCAT 0 false 0 sequence_with_flank ggcctgtgactgtctgcctgTCTGACCATtcgactgcctgttctgtgat 0 false Caenorhabditis elegans OREG0001775 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer B0507.1 B0507.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2833 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence ACGGTCAGT 0 false 0 sequence_with_flank gaagacagtgaccaaatataACGGTCAGTtgagcatgcggctgaatcaa 0 false Caenorhabditis elegans OREG0001776 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F11E6.8 F11E6.8 ENSEMBL caenorhabditis_elegans_core_33_140a 2834 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence AAGGTCAGA 0 false 0 sequence_with_flank attagagaggattgaagaggAAGGTCAGAtctaaagtggatcgtttttt 0 false Caenorhabditis elegans OREG0001777 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-1 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F38A6.1 pha-4 ENSEMBL caenorhabditis_elegans_core_33_140a 2835 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence CTGCGTCTCT 0 false 0 sequence_with_flank gctctttttctctcgtgttaCTGCGTCTCTatgtccattcccttctactc 0 false Caenorhabditis elegans OREG0001778 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F41H10.8 elo-6 ENSEMBL caenorhabditis_elegans_core_33_140a 2836 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TTTGACCGT 0 false 0 sequence_with_flank tatcaatagagttacaattcTTTGACCGTacattgagtgtgttctgaat 0 false Caenorhabditis elegans OREG0001779 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-1 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer F41H10.8 elo-6 ENSEMBL caenorhabditis_elegans_core_33_140a 2837 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence AGAGACGCAG 0 false 0 sequence_with_flank tacaagagagagagagagggAGAGACGCAGaaaacgagatggttaagtat 0 false Caenorhabditis elegans OREG0001780 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-1 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer K04H4.2a K04H4.2a ENSEMBL caenorhabditis_elegans_core_33_140a 2838 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TGAGACGCCT 0 false 0 sequence_with_flank ggcggcggttttacctcatcTGAGACGCCTtagtgttgctcccccaaata 0 false Caenorhabditis elegans OREG0001781 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-1 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer K04H4.2a K04H4.2a ENSEMBL caenorhabditis_elegans_core_33_140a 2839 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence AGAGACGAAA 0 false 0 sequence_with_flank cagtatacgcggagaggagaAGAGACGAAAgatagaaacgaagaagacgg 0 false Caenorhabditis elegans OREG0001782 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-1 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer T06D8.3 T06D8.3 ENSEMBL caenorhabditis_elegans_core_33_140a 2840 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence GGAGACGCAG 0 false 0 sequence_with_flank cctgaagcgcggagcccaacGGAGACGCAGactggctagttataccgtcc 0 false Caenorhabditis elegans OREG0001783 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer R02F11.1 R02F11.1 ENSEMBL caenorhabditis_elegans_core_33_140a 2841 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence AATGACCAT 0 false 0 sequence_with_flank tctcctcactgttacgtacaAATGACCATttagtcttgctgctccatcg 0 false Caenorhabditis elegans OREG0001784 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Early-2 9-Nov-2005 msleumer 9-Nov-2005 Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00028 OREGET00010 msleumer Co-expressed gene conservation 9-Nov-2005 OREGEC00001 OREGES00029 OREGET00010 msleumer C14C11.8 pqn-13 ENSEMBL caenorhabditis_elegans_core_33_140a 2842 POSITIVE OUTCOME 15492775 0 search_space EMPTY 0 false 0 sequence TCTGACCCT 0 false 0 sequence_with_flank ctgccctttgctccctctttTCTGACCCTtccatactgtccagctccaa 0 false Caenorhabditis elegans OREG0001785 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer F38G1.1 che-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2843 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGTCATGGTGAC 0 false 0 sequence_with_flank ctctgaattgctgccagctgGTTGTCATGGTGACtgctcgcgcatggctcagct 0 false Caenorhabditis elegans OREG0001786 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 F59C6.7 che-13 ENSEMBL caenorhabditis_elegans_core_33_140a 2844 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCTATAGCAAC 0 false 0 sequence_with_flank cccaggttttgcattcatgtGTTGCTATAGCAACcaatcctgagcagaacaagc 0 false Caenorhabditis elegans OREG0001787 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer T27B1.1 osm-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2845 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GCTACCATGGCAAC 0 false 0 sequence_with_flank ttgctcttgtgcatttcataGCTACCATGGCAACggagcacacaccagacggct 0 false Caenorhabditis elegans OREG0001788 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer Y41G9A.1 osm-5 ENSEMBL caenorhabditis_elegans_core_33_140a 2846 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTACTATGGCAAC 0 false 0 sequence_with_flank ctctctctcttgcttacataGTTACTATGGCAACgctccgctagcttgacgaaa 0 false Caenorhabditis elegans OREG0001789 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer R31.3 osm-6 ENSEMBL caenorhabditis_elegans_core_33_140a 2847 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTACCATAGTAAC 0 false 0 sequence_with_flank tccaagatttgtatccacatGTTACCATAGTAACcactcattgcttctcgctca 0 false Caenorhabditis elegans OREG0001790 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 Y105E8A.5 bbs-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2848 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTCCCATAGCAAC 0 false 0 sequence_with_flank ttcctgtggtgtccccccgtGTTCCCATAGCAACctgccaagcctccccctctc 0 false Caenorhabditis elegans OREG0001791 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer F20D12.3 bbs-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2849 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTATCCATGGCAAC 0 false 0 sequence_with_flank tacttccctctgctctttcaGTATCCATGGCAACatgtaagcacagcacacgcc 0 false Caenorhabditis elegans OREG0001792 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 R01H10.6 bbs-5 ENSEMBL caenorhabditis_elegans_core_33_140a 2850 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTCTCCATGGCAAC 0 false 0 sequence_with_flank tctctcttcgtttaccaccgGTCTCCATGGCAACtctgctcactcgggcggcga 0 false Caenorhabditis elegans OREG0001793 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 Y75B8A.12 bbs-7 ENSEMBL caenorhabditis_elegans_core_33_140a 2851 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTGCCATAGTAAC 0 false 0 sequence_with_flank ctgacccctctccagctcatGTTGCCATAGTAACtcgacaacaccagcgactcg 0 false Caenorhabditis elegans OREG0001794 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 T25F10.5 bbs-8 ENSEMBL caenorhabditis_elegans_core_33_140a 2852 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTACCCATGGCAAC 0 false 0 sequence_with_flank actctcttgccgcgtgccctGTACCCATGGCAACgacacgtctattcatatgcc 0 false Caenorhabditis elegans OREG0001795 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer F02D8.3 xbx-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2853 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTTCCATGGTAAC 0 false 0 sequence_with_flank tcgtttcttgttgaacgcccGTTTCCATGGTAACcgtcattttcggagtgcagc 0 false Caenorhabditis elegans OREG0001796 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 20-Oct-2005 F40F9.1 xbx-6 ENSEMBL caenorhabditis_elegans_core_33_140a 2854 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTTTCCATGGAAAC 0 false 0 sequence_with_flank ctcgtgagctggagaaccatGTTTCCATGGAAACtcgagtaatgtgataaacaa 0 false Caenorhabditis elegans OREG0001797 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The original sequence shown on the paper (GTATCCATGAAAAC) was not found in the upstream region of this gene. Instead, in the same position, another sequence (GTATCCATGGGAAC) was found, which has only two different bases from the original one. Since the wormbase WS122 was used for finding the sequences on this paper but we are using wormbase WS140 now, we think it might be possible that the sequences were changed from one wormbase version to another. Thus, the latter one was taken here. 20-Oct-2005 msleumer 20-Oct-2005 F53A2.4 nud-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2855 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence GTATCCATGGGAAC 0 false 0 sequence_with_flank gctttccccaggcacttgcaGTATCCATGGGAACatggcgaaaataggatttac 0 false Caenorhabditis elegans OREG0001798 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE The original sequence shown on the paper (ATCGTCATCGTAAC) was not found in the upstream region of this gene. Instead, around 40 bases away from the original position -164, another sequence (ATCGTCATGGTAAC) was found, which has only one different base from the original one. Since the wormbase WS122 was used for finding the sequences on this paper but we are using wormbase WS140 now, we think it might be possible that the sequences were changed from one wormbase version to another. Thus, the latter one was taken here. 20-Oct-2005 msleumer 20-Oct-2005 In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00002 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay (site KO, TF KO) 20-Oct-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer Y102E9.1 odr-4 ENSEMBL caenorhabditis_elegans_core_33_140a 2856 POSITIVE OUTCOME 15790967 0 search_space EMPTY 0 false 0 sequence ATCGTCATGGTAAC 0 false 0 sequence_with_flank tctcaatttcttgggtattcATCGTCATGGTAACcctctttttgtttgccacag 0 false Caenorhabditis elegans OREG0001799 F33H1.1 DAF-19 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This binding site is also a GATA1 site. 16-Nov-2005 msleumer 16-Nov-2005 LacZ reporter gene assay 16-Nov-2005 OREGEC00001 OREGES00030 OREGET00002 msleumer R12A1.4 ges-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2871 POSITIVE OUTCOME 7649372 0 search_space EMPTY 0 false 0 sequence ACTGATAG 0 false 0 sequence_with_flank tgcagatcagcactgatgcaACTGATAGcaaaactgataagggtcaaa 0 false Caenorhabditis elegans OREG0001817 C33D3.1 elt-2 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This binding site is also a GATA1 site. 16-Nov-2005 msleumer 16-Nov-2005 LacZ reporter gene assay 16-Nov-2005 OREGEC00001 OREGES00030 OREGET00002 msleumer R12A1.4 ges-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2872 POSITIVE OUTCOME 7649372 0 search_space EMPTY 0 false 0 sequence ACTGATAA 0 false 0 sequence_with_flank ctgatgcaactgatagcaaaACTGATAAgggtcaaaatttcagtggcc 0 false Caenorhabditis elegans OREG0001818 C33D3.1 elt-2 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This C.briggsae gene CBG06418 is the putative ortholog of the C.elegans gene R12A1.4. 16-Nov-2005 msleumer 16-Nov-2005 In-vivo GFP Expression Assay; Direct gel shift; Gel shift competition 16-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay; Direct gel shift; Gel shift competition 16-Nov-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer In-vivo GFP Expression Assay; Direct gel shift; Gel shift competition 16-Nov-2005 OREGEC00002 OREGES00003 OREGET00001 msleumer CBG06418 CBG06418 USER DEFINED Cb25 2873 POSITIVE OUTCOME 11784040 0 search_space EMPTY 0 false 0 sequence TGTGATAA 0 false 0 sequence_with_flank atttcgtgaagaaaaactgcTGTGATAAgaaaagtgttatactgataa 0 false Caenorhabditis briggsae OREG0001819 C33D3.1 elt-2 ENSEMBL Cb25 TRANSCRIPTION FACTOR BINDING SITE This C.briggsae gene CBG06418 is the putative ortholog of the C.elegans gene R12A1.4. 16-Nov-2005 msleumer 16-Nov-2005 In-vivo GFP Expression Assay; Direct gel shift; Gel shift competition 16-Nov-2005 OREGEC00001 OREGES00021 OREGET00002 msleumer In-vivo GFP Expression Assay; Direct gel shift; Gel shift competition 16-Nov-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer In-vivo GFP Expression Assay; Direct gel shift; Gel shift competition 16-Nov-2005 OREGEC00002 OREGES00003 OREGET00001 msleumer CBG06418 CBG06418 USER DEFINED Cb25 2874 POSITIVE OUTCOME 11784040 0 search_space EMPTY 0 false 0 sequence ACTGATAA 0 false 0 sequence_with_flank tgtgataagaaaagtgttatACTGATAAgaacgtagagtaacaaagtg 0 false Caenorhabditis briggsae OREG0001820 C33D3.1 elt-2 ENSEMBL Cb25 TRANSCRIPTION FACTOR BINDING SITE This binding site is named GATA1.1 site in the paper. 14-Nov-2005 msleumer 14-Nov-2005 LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00001 OREGES00030 OREGET00002 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00002 OREGES00030 OREGET00002 msleumer K11G9.6 mtl-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2875 POSITIVE OUTCOME 10514435 0 search_space EMPTY 0 false 0 sequence ACTGATAA 0 false 0 sequence_with_flank ttgcaaacaccttgtcaataACTGATAAaatcagaaactagagctgtg 0 false Caenorhabditis elegans OREG0001821 C33D3.1 elt-2 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This binding site is named GATA2.4 site in the paper. 14-Nov-2005 msleumer 14-Nov-2005 LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00001 OREGES00030 OREGET00002 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00002 OREGES00030 OREGET00002 msleumer T08G5.10 mtl-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2876 POSITIVE OUTCOME 10514435 0 search_space EMPTY 0 false 0 sequence TTATCAGC 0 false 0 sequence_with_flank attgtgataggcttgtgctgTTATCAGCtgcctcaaataggttgtcgc 0 false Caenorhabditis elegans OREG0001822 C33D3.1 elt-2 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE This binding site is named GATA2.1 site in the paper. 14-Nov-2005 msleumer 14-Nov-2005 LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00001 OREGES00030 OREGET00002 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00001 OREGES00003 OREGET00001 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00002 OREGES00001 OREGET00001 msleumer LacZ reporter gene assay; Direct gel shift; Gel shift competition 14-Nov-2005 OREGEC00002 OREGES00030 OREGET00002 msleumer T08G5.10 mtl-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2877 POSITIVE OUTCOME 10514435 0 search_space EMPTY 0 false 0 sequence ACTGATAA 0 false 0 sequence_with_flank ggcatgacttcacacacctaACTGATAAaggcctctatcacaaactag 0 false Caenorhabditis elegans OREG0001823 C33D3.1 elt-2 ENSEMBL caenorhabditis_elegans_core_33_140a TRANSCRIPTION FACTOR BINDING SITE 14-Nov-2005 LacZ reporter gene assay 14-Nov-2005 OREGEC00001 OREGES00030 OREGET00002 msleumer K11G9.6 mtl-1 ENSEMBL caenorhabditis_elegans_core_33_140a 2878 POSITIVE OUTCOME 10514435 0 search_space EMPTY 0 false 0 sequence ACACGTGTTTAAATGAATGTTGTGCTAAAAACGTCACATCAATGGTACGTGAATGTTGCAAACACCTTGTCAATAACTGATAAAATCAGAAACTAGAGCTGTGACTGAATCGTATACTAGAACGGAGTCTCTCTAAAAACGTTCTAAAAACAAACAAAAAATTGTGCAAAGGATTAGAGTGCTCAAGATCAATGAGCAAACTCACAATCAACTATCTGTTATTGTTTTGGGTCTCTTCTATATCTCTATTCTTTTAGTATCATAAGTTTGTACATTGTGACAGGGCCACCCTCTTTTATCACATATTTGAAGTGGTAAACAGCCAGCAAAAACCAAATAAAAAGGCAGTGAGAAAAAGAAGAAGGCAGCTCAATTTGACTGCTGAAATTAAGAAATC 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0001824 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION 14-Nov-2005 LacZ reporter gene assay 14-Nov-2005 OREGEC00001 OREGES00030 OREGET00002 msleumer T08G5.10 mtl-2 ENSEMBL caenorhabditis_elegans_core_33_140a 2879 POSITIVE OUTCOME 10514435 0 search_space EMPTY 0 false 0 sequence ACTGCAGGTGACCAAGTATGTTTGAGGCATGACTTCACACACCTAACTGATAAAGGCCTCTATCACAAACTAGAGTTGTGACGGAAAATTCAACTTCTCAGAATATAGCTCAAAATCTATCAAATTTTATTTTCAAAAATCCAAATAATTGTGCACGCAATGTACTTACTGCTTCATAAAGTTCAGAAGAATTGGATAAATTTGAATGAAGTTTTCAAAGCTTTTATCAGTGACTGTACATTGTGATAGGCTTGTGCTGTTATCAGCTGCCTCAAATAGGTTGTCGCTTGAAAATTTATATAAAAGGCCTACCAGCAGACATGAGAATCAAGCTTCAAAGGCTCTACTCAAAA 0 false 0 search_space EMPTY 0 false Caenorhabditis elegans OREG0001825 UNKNOWN UNKNOWN USER DEFINED REGULATORY REGION 4-May-2006 5-May-2006 OREG0001986 msleumer ) (Text: "Using this assay to delimit the enhancer further, we identified two overlapping fragments that also function as strong pharyngeal enhancers (Fig. 1B, pOK4.50 and pOK3.16). When assayed alone, the region of overlap functions only very weakly (pOK6.22). This analysis suggests the myo-2 enhancer contains several functional components that cooperate to activate transcription. Based on the deletion analysis, we provisionally divided the myo-2 enhancer into three overlapping fragments, designated A, B and C (fig. 1B). These fragments are individually inactive, but segments spanning A+B or B+C function as strong pharyngeal enhancers. A plausible working model is that the A, B and C fragments each contain a discreet subelement, with two or more subelements necessary for activity. Consistent with this model, we found that duplications of A, B or C functino as pharyngeal enhancers (Fig. 1C). Thus, each of these fragments contains sufficient information to independently activate transcription when duplicated. A combination of the C and A fragments also functions as a pharyngeal enhancer (Fig. 1C), indicating that the three fragments are mutually synergistic.") ]]> 4-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , ) (Text: "To map precisely the subelements within the B and C fragments, we synthesized a set of overlapping double-stranded oligonucleotides spanning B and C (Fig. 4). The oligonucleotides were individually ligated to form head-to-tail multimers that were assayed for enhancer function upstream of the myo-2::lacZ fusion (Table 1)...Multimers of a single oligonucleotide from the B fragment (B207) activate pharyngeal expression in a pattern very similar to that observed with the duplicated B fragment...Multimers of either of two overlapping oligonucleotides from the C fragment exhibit enhancer activity identical to that of the duplicated C fragment.")]]> 4-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer ) (Text: "To define the CEH-22 binding site, we used recombinant CEH-22 protein purified from E. coli to generate a DNAseI footprint on the B fragment of the myo-2 enhancer (Fig. 8). At high concentrations, recombinant CEH-22 protects the sequence TAAAGTGGTTGTGTG, which overlaps the 5' end of B207 by 13 bp.")]]> 4-May-2006 OREGEC00001 OREGES00015 OREGET00003 msleumer ) (Text: "To define the CEH-22 binding site, we used recombinant CEH-22 protein purified from E. coli to generate a DNAseI footprint on the B fragment of the myo-2 enhancer (Fig. 8). At high concentrations, recombinant CEH-22 protects the sequence TAAAGTGGTTGTGTG, which overlaps the 5' end of B207 by 13 bp.")]]> 4-May-2006 OREGEC00002 OREGES00015 OREGET00003 msleumer T18D3.4 T18D3.4 ENSEMBL caenorhabditis_elegans_core_32_140a 3031 UNKNOWN POSITIVE OUTCOME 7925019 0 search_space EMPTY 0 false 0 sequence TAAAGTGGTTGTGTG 0 false 0 sequence_with_flank taaagataagtctcaagataggttggtaatcgcTAAAGTGGTTGTGTGgataagagtagcaaaatggcaggaagagcactatttctattcagagttctatccaaca 0 false Caenorhabditis elegans OREG0001984 F29F11.5 F29F11.5 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 5-May-2006 17-May-2006 OREG0002033 msleumer ) (Text: "Using this assay to delimit the enhancer further, we identified two overlapping fragments that also function as strong pharyngeal enhancers (Fig. 1B, pOK4.50 and pOK3.16). When assayed alone, the region of overlap functions only very weakly (pOK6.22). This analysis suggests the myo-2 enhancer contains several functional components that cooperate to activate transcription. Based on the deletion analysis, we provisionally divided the myo-2 enhancer into three overlapping fragments, designated A, B and C (fig. 1B). These fragments are individually inactive, but segments spanning A+B or B+C function as strong pharyngeal enhancers. A plausible working model is that the A, B and C fragments each contain a discreet subelement, with two or more subelements necessary for activity. Consistent with this model, we found that duplications of A, B or C functino as pharyngeal enhancers (Fig. 1C). Thus, each of these fragments contains sufficient information to independently activate transcription when duplicated. A combination of the C and A fragments also functions as a pharyngeal enhancer (Fig. 1C), indicating that the three fragments are mutually synergistic.") ]]> 5-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , ) (Text: "To map precisely the subelements within the B and C fragments, we synthesized a set of overlapping double-stranded oligonucleotides spanning B and C (Fig. 4). The oligonucleotides were individually ligated to form head-to-tail multimers that were assayed for enhancer function upstream of the myo-2::lacZ fusion (Table 1)...Multimers of a single oligonucleotide from the B fragment (B207) activate pharyngeal expression in a pattern very similar to that observed with the duplicated B fragment...Multimers of either of two overlapping oligonucleotides from the C fragment exhibit enhancer activity identical to that of the duplicated C fragment.")]]> 5-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer ) (Text: "To define the CEH-22 binding site, we used recombinant CEH-22 protein purified from E. coli to generate a DNAseI footprint on the B fragment of the myo-2 enhancer (Fig. 8). At high concentrations, recombinant CEH-22 protects the sequence TAAAGTGGTTGTGTG, which overlaps the 5' end of B207 by 13 bp.")]]> 5-May-2006 OREGEC00001 OREGES00015 OREGET00003 msleumer ) (Text: "To define the CEH-22 binding site, we used recombinant CEH-22 protein purified from E. coli to generate a DNAseI footprint on the B fragment of the myo-2 enhancer (Fig. 8). At high concentrations, recombinant CEH-22 protects the sequence TAAAGTGGTTGTGTG, which overlaps the 5' end of B207 by 13 bp.")]]> 5-May-2006 OREGEC00002 OREGES00015 OREGET00003 msleumer T18D3.4 T18D3.4 ENSEMBL anopheles_gambiae_core_32_2g 3033 UNKNOWN POSITIVE OUTCOME 7925019 0 search_space EMPTY 0 false 0 sequence TAAAGTGGTTGTGTG 0 false 0 sequence_with_flank taaagataagtctcaagataggttggtaatcgcTAAAGTGGTTGTGTGgataagagtagcaaaatggcaggaagagcactt 0 false Caenorhabditis elegans OREG0001986 F29F11.5 F29F11.5 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 5-May-2006 17-May-2006 OREG0002034 msleumer , ) (Text: "We next assayed combinations of DE1, DE2, and DE3 for enhancer activity, and found they generally activated reporter gene expression in an additive rather than a synergistic pattern (Table 1). DE3 was unique in that it was a very strong pharyngeal muscle enhancer when assayed in two copies (Table 1, Fig. 2E), and it was active in all the larger pharyngeal muscles, including m6 in which neither ceh-22 nor the intact distal enhancer was frequently active (Kuchenthal et al., 2001 and Okkema and Fire, 1994). Taken together, these results suggest multiple developmental signals converge on the distal enhancer to regulate ceh-22 expression, and DE3 is an essential target of factors promoting pharyngeal muscle differentiation.")]]> 5-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , , ) (Text: "To determine how de199 or de209 contribute to DE3 activity, we deleted these sequences and assayed enhancer activity wild-type DE3 activated pharyngeal expression in 38% of the transformants (Table 2), and as described above, this expression was predominantly in ceh-22 expressing pharyngeal muscles and occasional pharyngeal intestinal valve and body wall muscle cells (Table 1 and data not shown). Deletion of de199 resulted in only a moderate decrease in enhancer activity (Table 2—DE3(Δde199)), and no change in cell type specificity (Table 1 and data not shown). In contrast, deletion of de209 resulted in a substantial decrease in enhancer activity (Table 2—DE3(Δde209)), and this activity was specifically reduced in the pharyngeal muscles and the pharyngeal–intestinal valve cells (Table 1 and data not shown). To ask if de199 and de209 function together to activate gene expression, we compared enhancer activity of a single copy of either de199 or de209 with an enhancer containing one copy of both de199 and de209. In assays with the egl-15two colonslacZ co-injection marker, the 1Xde199 and 1Xde209 enhancers exhibited little or no pharyngeal enhancer activity (Table 2). In contrast, 1Xde199 + 1Xde209 exhibited more frequent pharyngeal enhancer activity approaching that of the full DE3 fragment (Table 2). In assays without egl-15two colonslacZ, 1Xde199 + 1Xde209 activated frequent reporter gene expression in the pharyngeal muscle cells and occasionally in pharyngeal epithelial cells and marginal cells (Table 1, Fig. 4C, and data not shown). These data indicate that de209 is required for DE3 pharyngeal enhancer activity, and the combination of de209 and de199 activates transcription similarly to intact DE3.")]]> 5-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , ) (Text: "We assayed enhancer activity of de199 derivatives containing short substitutions (Fig. 5A), and found evidence for multiple activating and repressing sites. 5Xde199mut5 exhibited dramatically reduced pharyngeal enhancer activity when assayed with egl-15two colonslacZ (Table 2), indicating that this mutation affects an activator binding site. In contrast, 5Xde199mut2 and 5Xde199mut4 exhibited increased pharyngeal enhancer activity (Table 2), indicating that these mutations affect repressor binding sites.")]]> 5-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , ) (Text: "DE3 contains two conserved sites similar to the predicted PHA-4 consensus TRTTKRY within de209 (Gaudet and Mango, 2002) (Fig. 5B). We asked if PHA-4 recognized these sites in vitro, and found it bound de209 (Fig. 5C). A mutation in de209mut1-1 disrupting PHA-4 site 1 did not eliminate binding, while a mutation in de209mut2 disrupting both sites completely eliminated binding (Figs. 5B, C). These results indicate that PHA-4 binding is specific, although we cannot distinguish whether it binds both sites or only site 2.")]]> 5-May-2006 OREGEC00002 OREGES00003 OREGET00001 msleumer , ) (Text: "PHA-4 binding appears essential for activity of the DE3 enhancer, as deletion of these sites resulted in a substantial loss of enhancer activity (Fig. 3D, Table 2—DE3(ΔPHA-4))...Together these results suggest that PHA-4 activates ceh-22 expression directly through de209, and that other factors binding de209 function with PHA-4 to specifically activate ceh-22 in the pharyngeal muscles. ")]]> 5-May-2006 OREGEC00002 OREGES00030 OREGET00002 msleumer ) (Text: "Ectopic pha-4 expression could also activate the de209 enhancer in vivo. Expression of pha-4 using a heat shock promoter resulted in a large increase in the percent transformants expressing 5Xde209::Δpes-10::lacZ outside the pharynx when compared to wild-type worms (Table 3)...Together these results suggest that PHA-4 activates ceh-22 expression directly through de209, and that other factors binding de209 function with PHA-4 to specifically activate ceh-22 in the pharyngeal muscles.")]]> 5-May-2006 OREGEC00002 OREGES00030 OREGET00002 msleumer F29F11.5 F29F11.5 ENSEMBL anopheles_gambiae_core_32_2g 3034 UNKNOWN POSITIVE OUTCOME 14738885 0 search_space ATTTTCAGGTCGACGTCAATGATAGATTCTGGATATGAACTTTCAAAACGAGATGCGTCTACAATGGCTTAATTATCACACTTTTAAAATATTGCTACTCTAAAATGTCTTTTCAACTTTTCAGTGTTTATATCCGGTTTATATGTATTACGGGTCATGTCGTGTCAATAAAATGGTAATTGTATAAGAAGTGGGCCAATAGTGTGCTCTTTTATTTGTCATGTGTCCTGGTGGCAGAAATACAGTAATTTGATGCCTACACGCAACAGTAATACTTTACTAATCTCTTTTAACTAATATGTACACACAAACTTTCATGACCTTTGTTCGTTCGTTCCCTAATCTTAGTAAAAAAGTATAGAGAAGAGGATATTGTGAATCCATTTTGTGTGTGTAGGTGGAGAAACGCACACACAAATCAGCAAGGAACAAGAAGTTGAGCAAAAAAGATTACGGTAAGTGGACAAACAGATAACGCGGCCGTATTTTTGGATCCAAAAGCCAAA 0 false 0 sequence ACAAACAGATA 0 false 0 sequence_with_flank gagaagaggatattgtgaatccattttgtgtgtgtaggtggagaaacgcacacacaaatcagcaaggaacaagaagttgagcaaaaaagattacggtaagtggACAAACAGATAacgcggccgtatttttggatccaaaagccaaaattgttgatgaggaagattgatgatgcgcaaattagggagcagtttttggaaggtcaaagagaagcccgtccgcacgcatct 0 false Caenorhabditis elegans OREG0001988 F38A6.1 F38A6.1 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 17-May-2006 OREG0002032 msleumer ) (Text: "To explore the bases of coregulation of these genes, we dissected the cis-regulatory architecture of all eight known AIY-expressed genes by fusing different subfragments of their cis-regulatory regions to a gfp reporter (Chalfie et al., 1994) and monitoring gfp expression in transgenic worms containing each construct. For all the analyses presented in this paper, we have examined the expression of multiple transgenic lines and rarely found any qualitative differences between lines. Expression of reporters in AIY was unambiguously assessed with the use of an AIY-specific red fluorescent protein (RFP) transgene contained in the background. The cis-regulatory analysis for the eight known AIY expressed genes reveals that the regulatory regions of each AIY cell fate marker gene are highly modular with distinct cis-regulatory subregions, which often give reporter gene expression in single cellular subtypes, acting additively to create the expression patterns seen in the largest reporters (summarized in Figure 2; see Supplemental Figure S1 at http://www.developmentalcell.com/cgi/content/full/6/6/757/DC1 for pictures of transgenic animals). Moreover, for each gene we were able to define a small regulatory subregion that can drive expression in the AIY interneurons. Only little evidence of repressive cis-regulatory elements was observed in this analysis; that is, diminishing the size of cis-regulatory fragments rarely led to ectopic expression in new cell types.")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "We focused on motif identification in the 243 bp AIY-regulatory element of the ttx-3 locus. The transcription factor binding site prediction program TransFac (Wingender et al., 1996) predicted binding sites for several known transcription factors (e.g., AP1, Ftz-F1), yet we found that mutating these sites had no effect (Supplemental Figure S2). Hypothesizing that the homeodomain proteins that we previously identified as being necessary for AIY differentiation (Altun-Gultekin et al., 2001) might bind to this element, we next disrupted TAAN sequences, the core binding motif of many homeodomain transcription factors (Desplan et al. 1988 and Hoey and Levine 1988). Disruption of one of these motifs affected gfp reporter expression in AIY (Supplemental Figure S2). Through aligning the sequence surrounding this TAA motif with the minimal AIY-regulatory regions of the other AIY-expressed genes, we identified a common 16 bp motif which we term the "AIY-expressed cis-regulatory motif" (short: "AIY motif;" Figure 3).") ]]> 17-May-2006 OREGEC00001 OREGES00029 OREGET00010 msleumer ) (Text: "The necessity of this motif for expression in AIY was verified in each case by deleting the motif and confirming that transgenic animals expressing the mutant reporter construct lacked expression in AIY (Figure 2, Supplemental Figure S1, and data not shown). We determined the sufficiency of the core 16 bp AIY motif by placing a single copy of it into a gfp expression vector and observing expression in AIY in transgenic animals (Supplemental Figure S3A).")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "Analysis of the cis-regulatory regions of the C. briggsae orthologs of the eight AIY-expressed genes reveals that, with one exception (discussed below), this motif is phylogenetically conserved (Figure 3). Furthermore, the orientation and location of the motif in relation to the coding region of each orthologous gene pair (5' or within a specific intron; distance from start site) is conserved between C. elegans and C. briggsae (Supplemental Figures S4–S6).")]]> 17-May-2006 OREGEC00001 OREGES00028 OREGET00010 msleumer ) (Text: "The AIY neurons are generated, though inappropriately differentiated, in ceh-10 and ttx-3 mutants (Altun-Gultekin et al. 2001 and Forrester et al. 1998), suggesting that both ttx-3 and ceh-10 act postmitotically to determine terminal differentiation of AIY. We next tested whether these factors are also sufficient to induce AIY-like fate characteristics, as measured by their potential ability to ectopically activate the AIY motif. Broad ectopic coexpression of both genes, but not of either gene alone, under control of the unc-119 promoter, which is active in the hypodermis (early) and the nervous system (early and late), results in ectopic expression of the AIY motif in the hypodermis (Figure 5B). Therefore, these two factors are jointly required and, in a specific cellular context, also sufficient to control transcription through the AIY motif. Together with the crossregulatory interactions between ttx-3 and ceh-10, we hypothesize that TTX-3 and CEH-10 act in a self-stabilizing feedback loop to jointly regulate the expression of downstream target genes through the AIY motif.")]]> 17-May-2006 OREGEC00002 OREGES00021 OREGET00002 msleumer F44F4.13 F44F4.13 ENSEMBL anopheles_gambiae_core_32_2g 3084 sra-11 POSITIVE OUTCOME 15177025 0 search_space EMPTY 0 false 0 sequence TAATTAGTTTAGTTAG 0 false 0 sequence_with_flank gtgaaatgttttgaatctcctccgtgacttgtTAATTAGTTTAGTTAGtgcatttgtttgcaacatgagaaggctttgag 0 false Caenorhabditis elegans OREG0002029 W03A3.1 W03A3.1 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 17-May-2006 OREG0002035 msleumer ) (Text: "To explore the bases of coregulation of these genes, we dissected the cis-regulatory architecture of all eight known AIY-expressed genes by fusing different subfragments of their cis-regulatory regions to a gfp reporter (Chalfie et al., 1994) and monitoring gfp expression in transgenic worms containing each construct. For all the analyses presented in this paper, we have examined the expression of multiple transgenic lines and rarely found any qualitative differences between lines. Expression of reporters in AIY was unambiguously assessed with the use of an AIY-specific red fluorescent protein (RFP) transgene contained in the background. The cis-regulatory analysis for the eight known AIY expressed genes reveals that the regulatory regions of each AIY cell fate marker gene are highly modular with distinct cis-regulatory subregions, which often give reporter gene expression in single cellular subtypes, acting additively to create the expression patterns seen in the largest reporters (summarized in Figure 2; see Supplemental Figure S1 at http://www.developmentalcell.com/cgi/content/full/6/6/757/DC1 for pictures of transgenic animals). Moreover, for each gene we were able to define a small regulatory subregion that can drive expression in the AIY interneurons. Only little evidence of repressive cis-regulatory elements was observed in this analysis; that is, diminishing the size of cis-regulatory fragments rarely led to ectopic expression in new cell types.")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "We focused on motif identification in the 243 bp AIY-regulatory element of the ttx-3 locus. The transcription factor binding site prediction program TransFac (Wingender et al., 1996) predicted binding sites for several known transcription factors (e.g., AP1, Ftz-F1), yet we found that mutating these sites had no effect (Supplemental Figure S2). Hypothesizing that the homeodomain proteins that we previously identified as being necessary for AIY differentiation (Altun-Gultekin et al., 2001) might bind to this element, we next disrupted TAAN sequences, the core binding motif of many homeodomain transcription factors (Desplan et al. 1988 and Hoey and Levine 1988). Disruption of one of these motifs affected gfp reporter expression in AIY (Supplemental Figure S2). Through aligning the sequence surrounding this TAA motif with the minimal AIY-regulatory regions of the other AIY-expressed genes, we identified a common 16 bp motif which we term the "AIY-expressed cis-regulatory motif" (short: "AIY motif;" Figure 3).") ]]> 17-May-2006 OREGEC00001 OREGES00029 OREGET00010 msleumer ) (Text: "The necessity of this motif for expression in AIY was verified in each case by deleting the motif and confirming that transgenic animals expressing the mutant reporter construct lacked expression in AIY (Figure 2, Supplemental Figure S1, and data not shown). We determined the sufficiency of the core 16 bp AIY motif by placing a single copy of it into a gfp expression vector and observing expression in AIY in transgenic animals (Supplemental Figure S3A).")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "Analysis of the cis-regulatory regions of the C. briggsae orthologs of the eight AIY-expressed genes reveals that, with one exception (discussed below), this motif is phylogenetically conserved (Figure 3). Furthermore, the orientation and location of the motif in relation to the coding region of each orthologous gene pair (5' or within a specific intron; distance from start site) is conserved between C. elegans and C. briggsae (Supplemental Figures S4–S6).")]]> 17-May-2006 OREGEC00001 OREGES00028 OREGET00010 msleumer ) (Text: "The AIY neurons are generated, though inappropriately differentiated, in ceh-10 and ttx-3 mutants (Altun-Gultekin et al. 2001 and Forrester et al. 1998), suggesting that both ttx-3 and ceh-10 act postmitotically to determine terminal differentiation of AIY. We next tested whether these factors are also sufficient to induce AIY-like fate characteristics, as measured by their potential ability to ectopically activate the AIY motif. Broad ectopic coexpression of both genes, but not of either gene alone, under control of the unc-119 promoter, which is active in the hypodermis (early) and the nervous system (early and late), results in ectopic expression of the AIY motif in the hypodermis (Figure 5B). Therefore, these two factors are jointly required and, in a specific cellular context, also sufficient to control transcription through the AIY motif. Together with the crossregulatory interactions between ttx-3 and ceh-10, we hypothesize that TTX-3 and CEH-10 act in a self-stabilizing feedback loop to jointly regulate the expression of downstream target genes through the AIY motif.")]]> 17-May-2006 OREGEC00002 OREGES00021 OREGET00002 msleumer C36B7.7 C36B7.7 ENSEMBL anopheles_gambiae_core_32_2g 3085 hen-1 POSITIVE OUTCOME 15177025 0 search_space EMPTY 0 false 0 sequence AAATTGGCTTCCTCAA 0 false 0 sequence_with_flank tgatttgtctaattttgttgtgctcgcggaaattgcttttcaAAATTGGCTTCCTCAAagattatttgaatcattactatttcgaggtgtgaaactattt 0 false Caenorhabditis elegans OREG0002030 W03A3.1 W03A3.1 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 ) (Text: "To explore the bases of coregulation of these genes, we dissected the cis-regulatory architecture of all eight known AIY-expressed genes by fusing different subfragments of their cis-regulatory regions to a gfp reporter (Chalfie et al., 1994) and monitoring gfp expression in transgenic worms containing each construct. For all the analyses presented in this paper, we have examined the expression of multiple transgenic lines and rarely found any qualitative differences between lines. Expression of reporters in AIY was unambiguously assessed with the use of an AIY-specific red fluorescent protein (RFP) transgene contained in the background. The cis-regulatory analysis for the eight known AIY expressed genes reveals that the regulatory regions of each AIY cell fate marker gene are highly modular with distinct cis-regulatory subregions, which often give reporter gene expression in single cellular subtypes, acting additively to create the expression patterns seen in the largest reporters (summarized in Figure 2; see Supplemental Figure S1 at http://www.developmentalcell.com/cgi/content/full/6/6/757/DC1 for pictures of transgenic animals). Moreover, for each gene we were able to define a small regulatory subregion that can drive expression in the AIY interneurons. Only little evidence of repressive cis-regulatory elements was observed in this analysis; that is, diminishing the size of cis-regulatory fragments rarely led to ectopic expression in new cell types.")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "We focused on motif identification in the 243 bp AIY-regulatory element of the ttx-3 locus. The transcription factor binding site prediction program TransFac (Wingender et al., 1996) predicted binding sites for several known transcription factors (e.g., AP1, Ftz-F1), yet we found that mutating these sites had no effect (Supplemental Figure S2). Hypothesizing that the homeodomain proteins that we previously identified as being necessary for AIY differentiation (Altun-Gultekin et al., 2001) might bind to this element, we next disrupted TAAN sequences, the core binding motif of many homeodomain transcription factors (Desplan et al. 1988 and Hoey and Levine 1988). Disruption of one of these motifs affected gfp reporter expression in AIY (Supplemental Figure S2). Through aligning the sequence surrounding this TAA motif with the minimal AIY-regulatory regions of the other AIY-expressed genes, we identified a common 16 bp motif which we term the "AIY-expressed cis-regulatory motif" (short: "AIY motif;" Figure 3).") ]]> 17-May-2006 OREGEC00001 OREGES00029 OREGET00010 msleumer ) (Text: "The necessity of this motif for expression in AIY was verified in each case by deleting the motif and confirming that transgenic animals expressing the mutant reporter construct lacked expression in AIY (Figure 2, Supplemental Figure S1, and data not shown). We determined the sufficiency of the core 16 bp AIY motif by placing a single copy of it into a gfp expression vector and observing expression in AIY in transgenic animals (Supplemental Figure S3A).")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "Analysis of the cis-regulatory regions of the C. briggsae orthologs of the eight AIY-expressed genes reveals that, with one exception (discussed below), this motif is phylogenetically conserved (Figure 3). Furthermore, the orientation and location of the motif in relation to the coding region of each orthologous gene pair (5' or within a specific intron; distance from start site) is conserved between C. elegans and C. briggsae (Supplemental Figures S4–S6).")]]> 17-May-2006 OREGEC00001 OREGES00028 OREGET00010 msleumer ) (Text: "The AIY neurons are generated, though inappropriately differentiated, in ceh-10 and ttx-3 mutants (Altun-Gultekin et al. 2001 and Forrester et al. 1998), suggesting that both ttx-3 and ceh-10 act postmitotically to determine terminal differentiation of AIY. We next tested whether these factors are also sufficient to induce AIY-like fate characteristics, as measured by their potential ability to ectopically activate the AIY motif. Broad ectopic coexpression of both genes, but not of either gene alone, under control of the unc-119 promoter, which is active in the hypodermis (early) and the nervous system (early and late), results in ectopic expression of the AIY motif in the hypodermis (Figure 5B). Therefore, these two factors are jointly required and, in a specific cellular context, also sufficient to control transcription through the AIY motif. Together with the crossregulatory interactions between ttx-3 and ceh-10, we hypothesize that TTX-3 and CEH-10 act in a self-stabilizing feedback loop to jointly regulate the expression of downstream target genes through the AIY motif.")]]> 17-May-2006 OREGEC00002 OREGES00021 OREGET00002 msleumer F44F4.13 F44F4.13 ENSEMBL caenorhabditis_elegans_core_32_140a 3086 sra-11 POSITIVE OUTCOME 15177025 0 search_space EMPTY 0 false 0 sequence TAATTAGTTTAGTTAG 0 false 0 sequence_with_flank gtgaaatgttttgaatctcctccgtgacttgtTAATTAGTTTAGTTAGtgcatttgtttgcaacatgagaaggctttgag 0 false Caenorhabditis elegans OREG0002032 W03A3.1 W03A3.1 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 ) (Text: "Using this assay to delimit the enhancer further, we identified two overlapping fragments that also function as strong pharyngeal enhancers (Fig. 1B, pOK4.50 and pOK3.16). When assayed alone, the region of overlap functions only very weakly (pOK6.22). This analysis suggests the myo-2 enhancer contains several functional components that cooperate to activate transcription. Based on the deletion analysis, we provisionally divided the myo-2 enhancer into three overlapping fragments, designated A, B and C (fig. 1B). These fragments are individually inactive, but segments spanning A+B or B+C function as strong pharyngeal enhancers. A plausible working model is that the A, B and C fragments each contain a discreet subelement, with two or more subelements necessary for activity. Consistent with this model, we found that duplications of A, B or C functino as pharyngeal enhancers (Fig. 1C). Thus, each of these fragments contains sufficient information to independently activate transcription when duplicated. A combination of the C and A fragments also functions as a pharyngeal enhancer (Fig. 1C), indicating that the three fragments are mutually synergistic.") ]]> 17-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , ) (Text: "To map precisely the subelements within the B and C fragments, we synthesized a set of overlapping double-stranded oligonucleotides spanning B and C (Fig. 4). The oligonucleotides were individually ligated to form head-to-tail multimers that were assayed for enhancer function upstream of the myo-2::lacZ fusion (Table 1)...Multimers of a single oligonucleotide from the B fragment (B207) activate pharyngeal expression in a pattern very similar to that observed with the duplicated B fragment...Multimers of either of two overlapping oligonucleotides from the C fragment exhibit enhancer activity identical to that of the duplicated C fragment.")]]> 17-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer ) (Text: "To define the CEH-22 binding site, we used recombinant CEH-22 protein purified from E. coli to generate a DNAseI footprint on the B fragment of the myo-2 enhancer (Fig. 8). At high concentrations, recombinant CEH-22 protects the sequence TAAAGTGGTTGTGTG, which overlaps the 5' end of B207 by 13 bp.")]]> 17-May-2006 OREGEC00001 OREGES00015 OREGET00003 msleumer ) (Text: "To define the CEH-22 binding site, we used recombinant CEH-22 protein purified from E. coli to generate a DNAseI footprint on the B fragment of the myo-2 enhancer (Fig. 8). At high concentrations, recombinant CEH-22 protects the sequence TAAAGTGGTTGTGTG, which overlaps the 5' end of B207 by 13 bp.")]]> 17-May-2006 OREGEC00002 OREGES00015 OREGET00003 msleumer T18D3.4 T18D3.4 ENSEMBL caenorhabditis_elegans_core_32_140a 3087 UNKNOWN POSITIVE OUTCOME 7925019 0 search_space EMPTY 0 false 0 sequence TAAAGTGGTTGTGTG 0 false 0 sequence_with_flank taaagataagtctcaagataggttggtaatcgcTAAAGTGGTTGTGTGgataagagtagcaaaatggcaggaagagcactt 0 false Caenorhabditis elegans OREG0002033 F29F11.5 F29F11.5 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 , ) (Text: "We next assayed combinations of DE1, DE2, and DE3 for enhancer activity, and found they generally activated reporter gene expression in an additive rather than a synergistic pattern (Table 1). DE3 was unique in that it was a very strong pharyngeal muscle enhancer when assayed in two copies (Table 1, Fig. 2E), and it was active in all the larger pharyngeal muscles, including m6 in which neither ceh-22 nor the intact distal enhancer was frequently active (Kuchenthal et al., 2001 and Okkema and Fire, 1994). Taken together, these results suggest multiple developmental signals converge on the distal enhancer to regulate ceh-22 expression, and DE3 is an essential target of factors promoting pharyngeal muscle differentiation.")]]> 17-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , , ) (Text: "To determine how de199 or de209 contribute to DE3 activity, we deleted these sequences and assayed enhancer activity wild-type DE3 activated pharyngeal expression in 38% of the transformants (Table 2), and as described above, this expression was predominantly in ceh-22 expressing pharyngeal muscles and occasional pharyngeal intestinal valve and body wall muscle cells (Table 1 and data not shown). Deletion of de199 resulted in only a moderate decrease in enhancer activity (Table 2—DE3(Δde199)), and no change in cell type specificity (Table 1 and data not shown). In contrast, deletion of de209 resulted in a substantial decrease in enhancer activity (Table 2—DE3(Δde209)), and this activity was specifically reduced in the pharyngeal muscles and the pharyngeal–intestinal valve cells (Table 1 and data not shown). To ask if de199 and de209 function together to activate gene expression, we compared enhancer activity of a single copy of either de199 or de209 with an enhancer containing one copy of both de199 and de209. In assays with the egl-15two colonslacZ co-injection marker, the 1Xde199 and 1Xde209 enhancers exhibited little or no pharyngeal enhancer activity (Table 2). In contrast, 1Xde199 + 1Xde209 exhibited more frequent pharyngeal enhancer activity approaching that of the full DE3 fragment (Table 2). In assays without egl-15two colonslacZ, 1Xde199 + 1Xde209 activated frequent reporter gene expression in the pharyngeal muscle cells and occasionally in pharyngeal epithelial cells and marginal cells (Table 1, Fig. 4C, and data not shown). These data indicate that de209 is required for DE3 pharyngeal enhancer activity, and the combination of de209 and de199 activates transcription similarly to intact DE3.")]]> 17-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , ) (Text: "We assayed enhancer activity of de199 derivatives containing short substitutions (Fig. 5A), and found evidence for multiple activating and repressing sites. 5Xde199mut5 exhibited dramatically reduced pharyngeal enhancer activity when assayed with egl-15two colonslacZ (Table 2), indicating that this mutation affects an activator binding site. In contrast, 5Xde199mut2 and 5Xde199mut4 exhibited increased pharyngeal enhancer activity (Table 2), indicating that these mutations affect repressor binding sites.")]]> 17-May-2006 OREGEC00001 OREGES00030 OREGET00002 msleumer , ) (Text: "DE3 contains two conserved sites similar to the predicted PHA-4 consensus TRTTKRY within de209 (Gaudet and Mango, 2002) (Fig. 5B). We asked if PHA-4 recognized these sites in vitro, and found it bound de209 (Fig. 5C). A mutation in de209mut1-1 disrupting PHA-4 site 1 did not eliminate binding, while a mutation in de209mut2 disrupting both sites completely eliminated binding (Figs. 5B, C). These results indicate that PHA-4 binding is specific, although we cannot distinguish whether it binds both sites or only site 2.")]]> 17-May-2006 OREGEC00002 OREGES00003 OREGET00001 msleumer , ) (Text: "PHA-4 binding appears essential for activity of the DE3 enhancer, as deletion of these sites resulted in a substantial loss of enhancer activity (Fig. 3D, Table 2—DE3(ΔPHA-4))...Together these results suggest that PHA-4 activates ceh-22 expression directly through de209, and that other factors binding de209 function with PHA-4 to specifically activate ceh-22 in the pharyngeal muscles. ")]]> 17-May-2006 OREGEC00002 OREGES00030 OREGET00002 msleumer ) (Text: "Ectopic pha-4 expression could also activate the de209 enhancer in vivo. Expression of pha-4 using a heat shock promoter resulted in a large increase in the percent transformants expressing 5Xde209::Δpes-10::lacZ outside the pharynx when compared to wild-type worms (Table 3)...Together these results suggest that PHA-4 activates ceh-22 expression directly through de209, and that other factors binding de209 function with PHA-4 to specifically activate ceh-22 in the pharyngeal muscles.")]]> 17-May-2006 OREGEC00002 OREGES00030 OREGET00002 msleumer F29F11.5 F29F11.5 ENSEMBL caenorhabditis_elegans_core_32_140a 3088 UNKNOWN POSITIVE OUTCOME 14738885 0 search_space EMPTY 0 false 0 sequence ACAAACAGATA 0 false 0 sequence_with_flank gagaagaggatattgtgaatccattttgtgtgtgtaggtggagaaacgcacacacaaatcagcaaggaacaagaagttgagcaaaaaagattacggtaagtggACAAACAGATAacgcggccgtatttttggatccaaaagccaaaattgttgatgaggaagattgatgatgcgcaaattagggagcagtttttggaaggtcaaagagaagcccgtccgcacgcatct 0 false Caenorhabditis elegans OREG0002034 F38A6.1 F38A6.1 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 ) (Text: "To explore the bases of coregulation of these genes, we dissected the cis-regulatory architecture of all eight known AIY-expressed genes by fusing different subfragments of their cis-regulatory regions to a gfp reporter (Chalfie et al., 1994) and monitoring gfp expression in transgenic worms containing each construct. For all the analyses presented in this paper, we have examined the expression of multiple transgenic lines and rarely found any qualitative differences between lines. Expression of reporters in AIY was unambiguously assessed with the use of an AIY-specific red fluorescent protein (RFP) transgene contained in the background. The cis-regulatory analysis for the eight known AIY expressed genes reveals that the regulatory regions of each AIY cell fate marker gene are highly modular with distinct cis-regulatory subregions, which often give reporter gene expression in single cellular subtypes, acting additively to create the expression patterns seen in the largest reporters (summarized in Figure 2; see Supplemental Figure S1 at http://www.developmentalcell.com/cgi/content/full/6/6/757/DC1 for pictures of transgenic animals). Moreover, for each gene we were able to define a small regulatory subregion that can drive expression in the AIY interneurons. Only little evidence of repressive cis-regulatory elements was observed in this analysis; that is, diminishing the size of cis-regulatory fragments rarely led to ectopic expression in new cell types.")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "We focused on motif identification in the 243 bp AIY-regulatory element of the ttx-3 locus. The transcription factor binding site prediction program TransFac (Wingender et al., 1996) predicted binding sites for several known transcription factors (e.g., AP1, Ftz-F1), yet we found that mutating these sites had no effect (Supplemental Figure S2). Hypothesizing that the homeodomain proteins that we previously identified as being necessary for AIY differentiation (Altun-Gultekin et al., 2001) might bind to this element, we next disrupted TAAN sequences, the core binding motif of many homeodomain transcription factors (Desplan et al. 1988 and Hoey and Levine 1988). Disruption of one of these motifs affected gfp reporter expression in AIY (Supplemental Figure S2). Through aligning the sequence surrounding this TAA motif with the minimal AIY-regulatory regions of the other AIY-expressed genes, we identified a common 16 bp motif which we term the "AIY-expressed cis-regulatory motif" (short: "AIY motif;" Figure 3).") ]]> 17-May-2006 OREGEC00001 OREGES00029 OREGET00010 msleumer ) (Text: "The necessity of this motif for expression in AIY was verified in each case by deleting the motif and confirming that transgenic animals expressing the mutant reporter construct lacked expression in AIY (Figure 2, Supplemental Figure S1, and data not shown). We determined the sufficiency of the core 16 bp AIY motif by placing a single copy of it into a gfp expression vector and observing expression in AIY in transgenic animals (Supplemental Figure S3A).")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "Analysis of the cis-regulatory regions of the C. briggsae orthologs of the eight AIY-expressed genes reveals that, with one exception (discussed below), this motif is phylogenetically conserved (Figure 3). Furthermore, the orientation and location of the motif in relation to the coding region of each orthologous gene pair (5' or within a specific intron; distance from start site) is conserved between C. elegans and C. briggsae (Supplemental Figures S4–S6).")]]> 17-May-2006 OREGEC00001 OREGES00028 OREGET00010 msleumer ) (Text: "The AIY neurons are generated, though inappropriately differentiated, in ceh-10 and ttx-3 mutants (Altun-Gultekin et al. 2001 and Forrester et al. 1998), suggesting that both ttx-3 and ceh-10 act postmitotically to determine terminal differentiation of AIY. We next tested whether these factors are also sufficient to induce AIY-like fate characteristics, as measured by their potential ability to ectopically activate the AIY motif. Broad ectopic coexpression of both genes, but not of either gene alone, under control of the unc-119 promoter, which is active in the hypodermis (early) and the nervous system (early and late), results in ectopic expression of the AIY motif in the hypodermis (Figure 5B). Therefore, these two factors are jointly required and, in a specific cellular context, also sufficient to control transcription through the AIY motif. Together with the crossregulatory interactions between ttx-3 and ceh-10, we hypothesize that TTX-3 and CEH-10 act in a self-stabilizing feedback loop to jointly regulate the expression of downstream target genes through the AIY motif.")]]> 17-May-2006 OREGEC00002 OREGES00021 OREGET00002 msleumer C36B7.7 C36B7.7 ENSEMBL caenorhabditis_elegans_core_32_140a 3089 hen-1 POSITIVE OUTCOME 15177025 0 search_space EMPTY 0 false 0 sequence AAATTGGCTTCCTCAA 0 false 0 sequence_with_flank tgatttgtctaattttgttgtgctcgcggaaattgcttttcaAAATTGGCTTCCTCAAagattatttgaatcattactatttcgaggtgtgaaactattt 0 false Caenorhabditis elegans OREG0002035 W03A3.1 W03A3.1 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 ) (Text: "To explore the bases of coregulation of these genes, we dissected the cis-regulatory architecture of all eight known AIY-expressed genes by fusing different subfragments of their cis-regulatory regions to a gfp reporter (Chalfie et al., 1994) and monitoring gfp expression in transgenic worms containing each construct. For all the analyses presented in this paper, we have examined the expression of multiple transgenic lines and rarely found any qualitative differences between lines. Expression of reporters in AIY was unambiguously assessed with the use of an AIY-specific red fluorescent protein (RFP) transgene contained in the background. The cis-regulatory analysis for the eight known AIY expressed genes reveals that the regulatory regions of each AIY cell fate marker gene are highly modular with distinct cis-regulatory subregions, which often give reporter gene expression in single cellular subtypes, acting additively to create the expression patterns seen in the largest reporters (summarized in Figure 2; see Supplemental Figure S1 at http://www.developmentalcell.com/cgi/content/full/6/6/757/DC1 for pictures of transgenic animals). Moreover, for each gene we were able to define a small regulatory subregion that can drive expression in the AIY interneurons. Only little evidence of repressive cis-regulatory elements was observed in this analysis; that is, diminishing the size of cis-regulatory fragments rarely led to ectopic expression in new cell types.")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "We focused on motif identification in the 243 bp AIY-regulatory element of the ttx-3 locus. The transcription factor binding site prediction program TransFac (Wingender et al., 1996) predicted binding sites for several known transcription factors (e.g., AP1, Ftz-F1), yet we found that mutating these sites had no effect (Supplemental Figure S2). Hypothesizing that the homeodomain proteins that we previously identified as being necessary for AIY differentiation (Altun-Gultekin et al., 2001) might bind to this element, we next disrupted TAAN sequences, the core binding motif of many homeodomain transcription factors (Desplan et al. 1988 and Hoey and Levine 1988). Disruption of one of these motifs affected gfp reporter expression in AIY (Supplemental Figure S2). Through aligning the sequence surrounding this TAA motif with the minimal AIY-regulatory regions of the other AIY-expressed genes, we identified a common 16 bp motif which we term the "AIY-expressed cis-regulatory motif" (short: "AIY motif;" Figure 3).")]]> 17-May-2006 OREGEC00001 OREGES00029 OREGET00010 msleumer ) (Text: "The necessity of this motif for expression in AIY was verified in each case by deleting the motif and confirming that transgenic animals expressing the mutant reporter construct lacked expression in AIY (Figure 2, Supplemental Figure S1, and data not shown). We determined the sufficiency of the core 16 bp AIY motif by placing a single copy of it into a gfp expression vector and observing expression in AIY in transgenic animals (Supplemental Figure S3A).")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "The AIY neurons are generated, though inappropriately differentiated, in ceh-10 and ttx-3 mutants (Altun-Gultekin et al. 2001 and Forrester et al. 1998), suggesting that both ttx-3 and ceh-10 act postmitotically to determine terminal differentiation of AIY. We next tested whether these factors are also sufficient to induce AIY-like fate characteristics, as measured by their potential ability to ectopically activate the AIY motif. Broad ectopic coexpression of both genes, but not of either gene alone, under control of the unc-119 promoter, which is active in the hypodermis (early) and the nervous system (early and late), results in ectopic expression of the AIY motif in the hypodermis (Figure 5B). Therefore, these two factors are jointly required and, in a specific cellular context, also sufficient to control transcription through the AIY motif. Together with the crossregulatory interactions between ttx-3 and ceh-10, we hypothesize that TTX-3 and CEH-10 act in a self-stabilizing feedback loop to jointly regulate the expression of downstream target genes through the AIY motif.")]]> 17-May-2006 OREGEC00002 OREGES00021 OREGET00002 msleumer C02D4.2 C02D4.2 ENSEMBL caenorhabditis_elegans_core_32_140a 3090 ser-2 POSITIVE OUTCOME 15177025 0 search_space EMPTY 0 false 0 sequence TTATTGGCAAAATTAT 0 false 0 sequence_with_flank caatttacatacgaattccctcattctttccgagagtttcgtTTATTGGCAAAATTATtctttatgagagaatttctagttcaaagatga 0 false Caenorhabditis elegans OREG0002036 W03A3.1 W03A3.1 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE 17-May-2006 ) (Text: "To explore the bases of coregulation of these genes, we dissected the cis-regulatory architecture of all eight known AIY-expressed genes by fusing different subfragments of their cis-regulatory regions to a gfp reporter (Chalfie et al., 1994) and monitoring gfp expression in transgenic worms containing each construct. For all the analyses presented in this paper, we have examined the expression of multiple transgenic lines and rarely found any qualitative differences between lines. Expression of reporters in AIY was unambiguously assessed with the use of an AIY-specific red fluorescent protein (RFP) transgene contained in the background. The cis-regulatory analysis for the eight known AIY expressed genes reveals that the regulatory regions of each AIY cell fate marker gene are highly modular with distinct cis-regulatory subregions, which often give reporter gene expression in single cellular subtypes, acting additively to create the expression patterns seen in the largest reporters (summarized in Figure 2; see Supplemental Figure S1 at http://www.developmentalcell.com/cgi/content/full/6/6/757/DC1 for pictures of transgenic animals). Moreover, for each gene we were able to define a small regulatory subregion that can drive expression in the AIY interneurons. Only little evidence of repressive cis-regulatory elements was observed in this analysis; that is, diminishing the size of cis-regulatory fragments rarely led to ectopic expression in new cell types.")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "We focused on motif identification in the 243 bp AIY-regulatory element of the ttx-3 locus. The transcription factor binding site prediction program TransFac (Wingender et al., 1996) predicted binding sites for several known transcription factors (e.g., AP1, Ftz-F1), yet we found that mutating these sites had no effect (Supplemental Figure S2). Hypothesizing that the homeodomain proteins that we previously identified as being necessary for AIY differentiation (Altun-Gultekin et al., 2001) might bind to this element, we next disrupted TAAN sequences, the core binding motif of many homeodomain transcription factors (Desplan et al. 1988 and Hoey and Levine 1988). Disruption of one of these motifs affected gfp reporter expression in AIY (Supplemental Figure S2).")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "Through aligning the sequence surrounding this TAA motif with the minimal AIY-regulatory regions of the other AIY-expressed genes, we identified a common 16 bp motif which we term the "AIY-expressed cis-regulatory motif" (short: "AIY motif;" Figure 3).")]]> 17-May-2006 OREGEC00001 OREGES00029 OREGET00010 msleumer ) (Text: "The necessity of this motif for expression in AIY was verified in each case by deleting the motif and confirming that transgenic animals expressing the mutant reporter construct lacked expression in AIY (Figure 2, Supplemental Figure S1, and data not shown). We determined the sufficiency of the core 16 bp AIY motif by placing a single copy of it into a gfp expression vector and observing expression in AIY in transgenic animals (Supplemental Figure S3A).")]]> 17-May-2006 OREGEC00001 OREGES00021 OREGET00002 msleumer ) (Text: "Analysis of the cis-regulatory regions of the C. briggsae orthologs of the eight AIY-expressed genes reveals that, with one exception (discussed below), this motif is phylogenetically conserved (Figure 3). Furthermore, the orientation and location of the motif in relation to the coding region of each orthologous gene pair (5' or within a specific intron; distance from start site) is conserved between C. elegans and C. briggsae (Supplemental Figures S4–S6).")]]> 17-May-2006 OREGEC00001 OREGES00028 OREGET00010 msleumer ) (Text: "The AIY neurons are generated, though inappropriately differentiated, in ceh-10 and ttx-3 mutants (Altun-Gultekin et al. 2001 and Forrester et al. 1998), suggesting that both ttx-3 and ceh-10 act postmitotically to determine terminal differentiation of AIY. We next tested whether these factors are also sufficient to induce AIY-like fate characteristics, as measured by their potential ability to ectopically activate the AIY motif. Broad ectopic coexpression of both genes, but not of either gene alone, under control of the unc-119 promoter, which is active in the hypodermis (early) and the nervous system (early and late), results in ectopic expression of the AIY motif in the hypodermis (Figure 5B). Therefore, these two factors are jointly required and, in a specific cellular context, also sufficient to control transcription through the AIY motif. Together with the crossregulatory interactions between ttx-3 and ceh-10, we hypothesize that TTX-3 and CEH-10 act in a self-stabilizing feedback loop to jointly regulate the expression of downstream target genes through the AIY motif.") ]]> 17-May-2006 OREGEC00002 OREGES00021 OREGET00002 msleumer ) (Text: "We used electrophoretic mobility shift assays (EMSAs) to investigate whether the genetic involvement of ceh-10 and ttx-3 in AIY cell fate specification correlated with their ability to directly bind to the newly defined AIY motif. Using bacterially expressed, His-tagged, and purified CEH-10 and TTX-3 proteins, we show that CEH-10 and TTX-3 bind to the AIY motif derived from the cis-regulatory sequences of the ttx-3, ceh-10, kal-1, and inx-18 genes (Figures 5C–5E, data not shown; inx-18 is a newly identified, AIY-expressed gene that we describe below). Binding occurs in a strongly cooperative manner (Figures 5C–5E).")]]> 17-May-2006 OREGEC00002 OREGES00001 OREGET00001 msleumer ) (Text: "Specificity of binding was demonstrated by TTX-3 and CEH-10 still showing appreciable binding to this site even after the addition of 5000-fold excess specific unlabeled competitor probe. Moreover, mutated motifs are not as capable as the wild-type motif to compete for binding of TTX-3/CEH-10 to a labeled wild-type probe (Figure 5C). Additionally, involvement of TTX-3 in the CEH-10/TTX-3/DNA complex is specific since it cannot be replaced by LIN-11, another C. elegans LIM homeobox gene (Freyd et al., 1990; Figure 5C).")]]> 17-May-2006 OREGEC00001 OREGES00003 OREGET00001 msleumer C40H5.5 C40H5.5 ENSEMBL caenorhabditis_elegans_core_32_140a 3091 ttx-3 POSITIVE OUTCOME 15177025 0 search_space EMPTY 0 false 0 sequence TTATTGGCTTCGTTAA 0 false 0 sequence_with_flank gtcaaataatttgtttctcaagacttgaaataagtggcattgTTATTGGCTTCGTTAAgaaaaatagcgacatgataaaatacacgacct 0 false Caenorhabditis elegans OREG0002037 C40H5.5 C40H5.5 ENSEMBL caenorhabditis_elegans_core_32_140a TRANSCRIPTION FACTOR BINDING SITE This site overlaps with the T3 Receptor site annotated as OREG0002464 30-Nov-2006 msleumer 30-Nov-2006 Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (Sp1) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00002 OREGES00033 OREGET00003 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (Sp1) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00001 OREGES00003 OREGET00001 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (Sp1) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00002 OREGES00003 OREGET00001 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (Sp1) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00001 OREGES00004 OREGET00002 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (Sp1) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00002 OREGES00004 OREGET00002 msleumer ENSG00000146648 EGFR ENSEMBL homo_sapiens_core_41_36c 4150 POSITIVE OUTCOME 8393457 0 search_space gcgtccgcccgaGTCCCCGCCTCgccgccaacgcca 0 false 0 sequence GTCCCCGCCTC 0 false 0 sequence_with_flank ccccggcggccgccgccgcccagaccggacgacaggccacctcgtcggcgtccgcccgaGTCCCCGCCTCgccgccaacgccacaaccaccgcgcacggccccctgactccgtccagtattgatcgggagagccggagcgagctctt 0 false Homo sapiens OREG0002428 6667 SP1 NCBI TRANSCRIPTION FACTOR BINDING SITE This site overlaps with the Sp1 site annotated as OREG0002428 30-Nov-2006 msleumer 30-Nov-2006 Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (T3 Receptor) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00002 OREGES00033 OREGET00003 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (T3 Receptor) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00001 OREGES00003 OREGET00001 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (T3 Receptor) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00002 OREGES00003 OREGET00001 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (T3 Receptor) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00001 OREGES00004 OREGET00002 msleumer Experiments done in Drosophila Schneider SL2 cells using a cotransfection of the sequence with a reporter gene, the transcription factor (T3 Receptor) under the control of a galactosidase promoter, and the galactosidase promoter activator 30-Nov-2006 OREGEC00002 OREGES00004 OREGET00002 msleumer ENSG00000146648 EGFR ENSEMBL homo_sapiens_core_41_36c 4156 POSITIVE OUTCOME 8393457 0 search_space gcgtccgcccGAGTCCCcgcctcgccgccaacgcca 0 false 0 sequence GAGTCCC 0 false 0 sequence_with_flank gcccgacgcggccgaggcggccggagtcccgagctagccccggcggccgccgccgcccagaccggacgacaggccacctcgtcggcgtccgcccGAGTCCCcgcctcgccgccaacgccacaaccaccgcgcacggccccctgactccgtccagtattgatcgggagagccggagcgagctcttcggggagcagcgatgcgaccctccgggacggccggggcagc 0 false Homo sapiens OREG0002464 7067 THRA NCBI TRANSCRIPTION FACTOR BINDING SITE The c-Myc-like sequences CACGTC were found not to bind c-Myc 6-Dec-2006 msleumer 6-Dec-2006 The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00001 OREGES00003 OREGET00001 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00002 OREGES00002 OREGET00001 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00001 OREGES00019 OREGET00002 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00002 OREGES00019 OREGET00002 msleumer 6-Dec-2006 OREGEC00001 OREGES00015 OREGET00003 msleumer ENSRNOG00000034013 Acaca ENSEMBL rattus_norvegicus_core_41_34k 4555 POSITIVE OUTCOME 8576128 0 search_space caccacgtcccagacccgcccgccctcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctcacgtcGCCCCGCCCCGCGccgcgcgcccat 0 false 0 sequence GCCCCGCCCCGCG 0 false 0 sequence_with_flank cgtcccagacccgcccgccctcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctcacgtcGCCCCGCCCCGCGccgcgcgcccattggctgacgcccgcccgagcccgcgcctcgcccccaccccctggcgctcagaccgcgcggctgcccgg 0 false Rattus norvegicus OREG0002866 ENSRNOG00000014084 Sp1 ENSEMBL rattus_norvegicus_core_41_34k TRANSCRIPTION FACTOR BINDING SITE The c-Myc-like sequences CACGTC were found not to bind c-Myc 6-Dec-2006 msleumer 6-Dec-2006 The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00001 OREGES00003 OREGET00001 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00002 OREGES00002 OREGET00001 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00001 OREGES00019 OREGET00002 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00002 OREGES00019 OREGET00002 msleumer 6-Dec-2006 OREGEC00001 OREGES00015 OREGET00003 msleumer ENSRNOG00000034013 Acaca ENSEMBL rattus_norvegicus_core_41_34k 4556 POSITIVE OUTCOME 8576128 0 search_space caccacgtcccagACCCGCCCGCCCTcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctcacgtcgccccgccccgcgccgcgcgcccat 0 false 0 sequence ACCCGCCCGCCCT 0 false 0 sequence_with_flank ccgctctccgccgggaggtggagccgttgggctggccccaaacccgcccaggcagaaggggcacccaccacgtcccagACCCGCCCGCCCTcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctcacgtcgccccgccccgcgccgcgcgc 0 false Rattus norvegicus OREG0002867 ENSRNOG00000014084 Sp1 ENSEMBL rattus_norvegicus_core_41_34k TRANSCRIPTION FACTOR BINDING SITE 2 positive outcome Sp1 sites are reported in this paper (OREG0002866 and OREG0002867), and 2 sites were shown *not* to be bound by c-Myc 6-Dec-2006 msleumer 6-Dec-2006 The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00002 OREGES00002 OREGET00001 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00001 OREGES00003 OREGET00001 msleumer ENSRNOG00000034013 Acaca ENSEMBL rattus_norvegicus_core_41_34k 4557 NEGATIVE OUTCOME 8576128 0 search_space cacCACGTCccagacccgcccgccctcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctcacgtcgccccgccccgcgccgcgcgcccat 0 false 0 sequence CACGTC 0 false 0 sequence_with_flank ccgctctccgccgggaggtggagccgttgggctggccccaaacccgcccaggcagaaggggcacccacCACGTCccagacccgcccgccctcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctcacgtcgccccgcccc 0 false Rattus norvegicus OREG0002868 ENSRNOG00000004500 Myc ENSEMBL rattus_norvegicus_core_41_34k TRANSCRIPTION FACTOR BINDING SITE 2 positive outcome Sp1 sites are reported in this paper (OREG0002866 and OREG0002867), and 2 sites were shown *not* to be bound by c-Myc 6-Dec-2006 msleumer 6-Dec-2006 The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00002 OREGES00002 OREGET00001 msleumer The cell type was Drosophila Schneider SL2 6-Dec-2006 OREGEC00001 OREGES00003 OREGET00001 msleumer ENSRNOG00000034013 Acaca ENSEMBL rattus_norvegicus_core_41_34k 4558 NEGATIVE OUTCOME 8576128 0 search_space caccacgtcccagacccgcccgccctcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctCACGTCgccccgccccgcgccgcgcgcccat 0 false 0 sequence CACGTC 0 false 0 sequence_with_flank caccacgtcccagacccgcccgccctcgcaccgctcggccccgaatggcagaacagagctcggaccatcggcatcgcctCACGTCgccccgccccgcgccgcgcgcccattggctgacgcccgcccgagcccgcgcctcgcccccaccccctggcgctcagacc 0 false Rattus norvegicus OREG0002869 ENSRNOG00000004500 Myc ENSEMBL rattus_norvegicus_core_41_34k TRANSCRIPTION FACTOR BINDING SITE Homo sapiens 9606 Caenorhabditis elegans 6239 Caenorhabditis briggsae 6238 Rattus norvegicus 10116 msleumer TNFRSF10B is an aliase of Death receptor 5(DR5, TRAIL-R2) 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00004 OREGET00002 mzhang 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang 16-Aug-2005 OREGEC00001 OREGES00005 OREGET00003 mzhang 16-Aug-2005 OREGEC00001 OREGES00006 OREGET00004 mzhang ENSG00000120889 TNFRSF10B ENSEMBL homo_sapiens_core_31_35d 89 POSITIVE OUTCOME 15964798 0 search_space EMPTY 0 false 0 sequence GGGCATGTCCGGGCAA 0 false 0 sequence_with_flank ggcccgggtcgcctgcggccGGGCATGTCCGGGCAAgacgcaccagtcgtcggagt 0 false Homo sapiens OREG0000160 ENSG00000141510 p53 ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE TNFRSF10B is an aliase of Death receptor 5(DR5, TRAIL-R2) 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00004 OREGET00002 mzhang 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang 16-Aug-2005 OREGEC00001 OREGES00005 OREGET00003 mzhang 16-Aug-2005 OREGEC00001 OREGES00006 OREGET00004 mzhang ENSG00000120889 TNFRSF10B ENSEMBL homo_sapiens_core_31_35d 90 POSITIVE OUTCOME 15964798 0 search_space EMPTY 0 false 0 sequence GGGAATTCCC 0 false 0 sequence_with_flank gtgggggagggcgacaaggaGGGAATTCCCgagtaagctgcgtgaagcca 0 false Homo sapiens OREG0000161 NF-kB NF-kB USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Binding site1 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00004 OREGET00002 mzhang 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang 16-Aug-2005 OREGEC00001 OREGES00005 OREGET00003 mzhang ENSG00000112715 VEGF ENSEMBL homo_sapiens_core_31_35d 91 POSITIVE OUTCOME 15970595 0 search_space EMPTY 0 false 0 sequence GGGCGG 0 false 0 sequence_with_flank tcgcctgtccccgccccccgGGGCGGgccgggggcggggtcccggc 0 false Homo sapiens OREG0000162 ENSG00000185591 Sp1 ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE Binding site2 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00004 OREGET00002 mzhang 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang 16-Aug-2005 OREGEC00001 OREGES00005 OREGET00003 mzhang ENSG00000112715 VEGF ENSEMBL homo_sapiens_core_31_35d 92 POSITIVE OUTCOME 15970595 0 search_space EMPTY 0 false 0 sequence GGGCGG 0 false 0 sequence_with_flank cgccccccggggcgggccggGGGCGGggtcccggcggggcggagcc 0 false Homo sapiens OREG0000163 ENSG00000185591 Sp1 ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE Binding site3 16-Aug-2005 mzhang 16-Aug-2005 23-Apr-2007 OREG0003015 bcb 16-Aug-2005 OREGEC00001 OREGES00004 OREGET00002 mzhang 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang 16-Aug-2005 OREGEC00001 OREGES00005 OREGET00003 mzhang ENSG00000112715 VEGF ENSEMBL homo_sapiens_core_31_35d 93 POSITIVE OUTCOME 15970595 0 search_space EMPTY 0 false 0 sequence GGGCGG 0 false 0 sequence_with_flank ccggGGGCGGggtcccggcgGGGCGGagccatgcgccccccccttt 0 false Homo sapiens OREG0000164 ENSG00000185591 Sp1 ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00004 OREGET00002 mzhang 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang ENSG00000120889 TNFRSF10B ENSEMBL homo_sapiens_core_31_35d 94 POSITIVE OUTCOME 15994939 0 search_space EMPTY 0 false 0 sequence GAGGATTGCGTTG 0 false 0 sequence_with_flank cccacttggacgcgcttgcgGAGGATTGCGTTGacgagactcttatttattgt 0 false Homo sapiens OREG0000165 ENSG00000175197 CHOP ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE Binding site 1 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang ENSG00000113916 BCL6 ENSEMBL homo_sapiens_core_31_35d 95 POSITIVE OUTCOME 15892171 0 search_space EMPTY 0 false 0 sequence GAGGAA 0 false 0 sequence_with_flank aacattttgggctaattcttGAGGAAtctgaaatattattttcccc 0 false Homo sapiens OREG0000166 ENSG00000066336 SPI1 (PU.1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE Binding site 2 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang ENSG00000113916 BCL6 ENSEMBL homo_sapiens_core_31_35d 96 POSITIVE OUTCOME 15892171 0 search_space EMPTY 0 false 0 sequence AAGGAA 0 false 0 sequence_with_flank aaagtaatagagaaaaagagAAGGAAagaatttctccttcttctct 0 false Homo sapiens OREG0000167 ENSG00000066336 SPI1 (PU.1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE Binding site 4 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00001 OREGES00000 OREGET00001 mzhang ENSG00000113916 BCL6 ENSEMBL homo_sapiens_core_31_35d 97 POSITIVE OUTCOME 15892171 0 search_space EMPTY 0 false 0 sequence AAGGAA 0 false 0 sequence_with_flank tgagtttatgggtaagaaagAAGGAAttagccccagaccccgggaa 0 false Homo sapiens OREG0000168 ENSG00000066336 SPI1 (PU.1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE Found TF ?MYF?? so the TF might be one gene in MYF family 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000109063 MYH3 ENSEMBL homo_sapiens_core_31_35d 98 POSITIVE OUTCOME 11971910 0 search_space EMPTY 0 false 0 sequence CCAGCAGCTGGT 0 false 0 sequence_with_flank ttccccctaccccatcccagCCAGCAGCTGGTctttcctaattggtaatctg 0 false Homo sapiens OREG0000169 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE Found TF ?MYF?? so the TF might be one gene in MYF family 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000109063 MYH3 ENSEMBL homo_sapiens_core_31_35d 99 POSITIVE OUTCOME 11971910 0 search_space EMPTY 0 false 0 sequence GGCAGCTGTCG 0 false 0 sequence_with_flank ttaatagccacaggtcctcaGGCAGCTGTCGccgggaatacgagctggcag 0 false Homo sapiens OREG0000170 UNKNOWN UNKNOWN USER DEFINED TRANSCRIPTION FACTOR BINDING SITE MEF can be found on NCBI but not on Ensembl website. It has two aliases, ELF4 and MEFV, but it is hard to decide which one it's what we want 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000175084 DES ENSEMBL homo_sapiens_core_31_35d 100 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTCTATAAATACCC 0 false 0 sequence_with_flank tttcccagccatgcgttctcCTCTATAAATACCCgctctggtatttggggttgg 0 false Homo sapiens OREG0000171 MEF MEF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE TF might be one gene in MYF family 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000175084 DES ENSEMBL homo_sapiens_core_31_35d 101 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TTGGCAGCTGTTGC 0 false 0 sequence_with_flank acccgctctggtatttggggTTGGCAGCTGTTGCtgccagggagatggttgggt 0 false Homo sapiens OREG0000172 MYF MYF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE TF might be one gene in MYF family 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000175084 DES ENSEMBL homo_sapiens_core_31_35d 102 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTTGCAGCTGTCAG 0 false 0 sequence_with_flank tcctggcaggacagcgggatCTTGCAGCTGTCAGgggaggggaggcgggggctg 0 false Homo sapiens OREG0000173 MYF MYF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE TF might be one gene in MYF family 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000122180 MYOG ENSEMBL homo_sapiens_core_31_35d 103 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GAATCACATCTAAT 0 false 0 sequence_with_flank ccatgcgggagaaagaagggGAATCACATCTAATccactgtaaacgccttgatg 0 false Homo sapiens OREG0000174 MYF MYF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE MEF cannot be found on NCBI but not on Ensembl website. It has two aliases, ELF4 and MEFV, but it is hard to decide which one it's what we want 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000122180 MYOG ENSEMBL homo_sapiens_core_31_35d 104 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GGCTATATTTATCT 0 false 0 sequence_with_flank gctcaggtttctgtggcgttGGCTATATTTATCTctggttccatgccagcgggg 0 false Homo sapiens OREG0000175 MEF MEF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE TF might be one gene in MYF family 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000122180 MYOG ENSEMBL homo_sapiens_core_31_35d 105 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CCAGCAGTTGGCGT 0 false 0 sequence_with_flank ggggagggtttaaatggcacCCAGCAGTTGGCGTgaggggctgctggagcttgg 0 false Homo sapiens OREG0000176 MYF MYF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE MEF cannot be found on NCBI but not on Ensembl website. It has two aliases, ELF4 and MEFV, but it is hard to decide which one it's what we want 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000159173 TNNI ENSEMBL homo_sapiens_core_31_35d 106 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AGACTATAATAGCC 0 false 0 sequence_with_flank gccccaacccatgagatgacAGACTATAATAGCCacaggattaacatagcaggc 0 false Homo sapiens OREG0000177 MEF MEF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000159173 TNNI ENSEMBL homo_sapiens_core_31_35d 107 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence ACATAGCAGGCATT 0 false 0 sequence_with_flank ctataatagccacaggattaACATAGCAGGCATTgtctttctctgactataggg 0 false Homo sapiens OREG0000178 ENSG00000143748 NVL ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE TF might be one gene in MYF family 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000159173 TNNI ENSEMBL homo_sapiens_core_31_35d 108 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TAAACAGGTGCAGC 0 false 0 sequence_with_flank accatcctaaaaatacccggTAAACAGGTGCAGCccctgtggctccagtcccct 0 false Homo sapiens OREG0000179 MYF MYF USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000092054 MYH7 ENSEMBL homo_sapiens_core_31_35d 109 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTGTGGAATGTGA 0 false 0 sequence_with_flank tcagttccctctcctgccagCTGTGGAATGTGAggcctggcctgggagatatt 0 false Homo sapiens OREG0000180 ENSG00000167074 TEF ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000197616 MYH6 ENSEMBL homo_sapiens_core_31_35d 110 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GGGAGGAATGTGC 0 false 0 sequence_with_flank tgctcatcagccctttgaagGGGAGGAATGTGCccaaggactaaaaaaaggcc 0 false Homo sapiens OREG0000181 ENSG00000167074 TEF ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000197616 MYH6 ENSEMBL homo_sapiens_core_31_35d 111 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTCCAAATTTAGAC 0 false 0 sequence_with_flank ggagggtccctccggaaggaCTCCAAATTTAGACagagggtgggggaaacggga 0 false Homo sapiens OREG0000182 ENSG00000112658 SRF ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000150526 MIA2 ENSEMBL homo_sapiens_core_31_35d 112 POSITIVE OUTCOME 12586826 0 search_space EMPTY 0 false 0 sequence TTAGTCCAACTAAAAA 0 false 0 sequence_with_flank tgggcttcctttataacacaTTAGTCCAACTAAAAAtccttgttaattattaaacc 0 false Homo sapiens OREG0000183 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000198610 AKR1C4 ENSEMBL homo_sapiens_core_31_35d 113 POSITIVE OUTCOME 12220531 0 search_space EMPTY 0 false 0 sequence ATGTCCAAAGTCCAAACAT 0 false 0 sequence_with_flank ctgtttgcatgttgcaaatgATGTCCAAAGTCCAAACATtgttaataattaatactcca 0 false Homo sapiens OREG0000184 ENSG00000101076 HNF4A (HNF4) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000198610 AKR1C4 ENSEMBL homo_sapiens_core_31_35d 114 POSITIVE OUTCOME 11284743 0 search_space EMPTY 0 false 0 sequence TGTTAATAATTAATACT 0 false 0 sequence_with_flank gatgtccaaagtccaaacatTGTTAATAATTAATACTccaataaacatcatgtcaga 0 false Homo sapiens OREG0000185 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000180432 CYP8B1 ENSEMBL homo_sapiens_core_31_35d 115 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TTGCGGCCACAGGGCAAGGTCCAGGTG 0 false 0 sequence_with_flank ctagtgttatttgccataacTTGCGGCCACAGGGCAAGGTCCAGGTGctcagacctttacatcctgg 0 false Homo sapiens OREG0000186 ENSG00000101076 HNF4A ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000126218 F10 ENSEMBL homo_sapiens_core_31_35d 116 POSITIVE OUTCOME 11159521 0 search_space EMPTY 0 false 0 sequence GGGGCGTGGACTTTGCTCCAGC 0 false 0 sequence_with_flank agacaacagccatcccagctGGGGCGTGGACTTTGCTCCAGCagcctgtcccagtgaggaca 0 false Homo sapiens OREG0000187 ENSG00000101076 HNF4A ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000136872 ALDOB ENSEMBL homo_sapiens_core_31_35d 117 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TGTTTTATGATTAACA 0 false 0 sequence_with_flank tgaacattggcctgtgacccTGTTTTATGATTAACAgagaggtgacatttgtgcta 0 false Homo sapiens OREG0000188 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000136872 ALDOB ENSEMBL homo_sapiens_core_31_35d 118 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AGGAGTACGGAAATCGTTC 0 false 0 sequence_with_flank atctgagagagcagaggcttAGGAGTACGGAAATCGTTCtttgtcattacccatcccag 0 false Homo sapiens OREG0000189 ENSG00000101076 HNF4A (HNF4) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE TF ?BRF-3? cannot be found on NCBI. Probably ?3? doesn't make any sense here and TF might be BRF. BRF has an aliase BRF1. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 119 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTGCGGGGCTGAGTGCCCTTCTCGGTTGCTG 0 false 0 sequence_with_flank ccgcgcattcccaccgggacCTGCGGGGCTGAGTGCCCTTCTCGGTTGCTGccgctgaggagcccgcccag 0 false Homo sapiens OREG0000190 BRF-3 BRF-3 USER DEFINED TRANSCRIPTION FACTOR BINDING SITE TF ?BRF-4? cannot be found on NCBI. Probably ?4? doesn't make any sense here and TF might be BRF. BRF has an aliase BRF1. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 120 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GTTGCTGCCGCTGAGGAGCC 0 false 0 sequence_with_flank ggggctgagtgcccttctcgGTTGCTGCCGCTGAGGAGCCcgcccagccagccagggccg 0 false Homo sapiens OREG0000191 BRF-4 BRF-4 USER DEFINED TRANSCRIPTION FACTOR BINDING SITE CEBP has an aliase 1833 but there is no ensembl gene with HUGO ID 1833. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 121 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TGGACCTTTTGCAATCCTGG 0 false 0 sequence_with_flank caggcccgggaggcgcccttTGGACCTTTTGCAATCCTGGcgctcttgcagcctgggctt 0 false Homo sapiens OREG0000192 C/EBP-alpha (CEBP) C/EBP-alpha (CEBP) USER DEFINED TRANSCRIPTION FACTOR BINDING SITE CEBP has an aliase 1833 but there is no ensembl gene with HUGO ID 1833. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 122 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GCGCTCTTGCAGCCTGGGCT 0 false 0 sequence_with_flank ttggaccttttgcaatcctgGCGCTCTTGCAGCCTGGGCTtcctataaatggggtgcggg 0 false Homo sapiens OREG0000193 C/EBP-alpha (CEBP) C/EBP-alpha (CEBP) USER DEFINED TRANSCRIPTION FACTOR BINDING SITE CEBP has an aliase 1833 but there is no ensembl gene with HUGO ID 1833. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 123 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AAGCCAGTGTAGAAAAGCAAA 0 false 0 sequence_with_flank gctcttcaaggctcaaagagAAGCCAGTGTAGAAAAGCAAAcaggtcaggcccgggaggcg 0 false Homo sapiens OREG0000194 C/EBP-alpha (CEBP) C/EBP-alpha (CEBP) USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 124 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CGGGAGGCGCCCTTTGGACCTTTTG 0 false 0 sequence_with_flank aaaagcaaacaggtcaggccCGGGAGGCGCCCTTTGGACCTTTTGcaatcctggcgctcttgcag 0 false Homo sapiens OREG0000195 ENSG00000101076 HNF4A (HNF4) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 125 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTGTTTATCAGTG 0 false 0 sequence_with_flank tttgaagaaacatcactgtcCTGTTTATCAGTGactagtcattgattcgaagc 0 false Homo sapiens OREG0000196 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE CEBP has an aliase 1833 but there is no ensembl gene with HUGO ID 1833. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000084674 APOB ENSEMBL homo_sapiens_core_31_35d 126 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence ATGTGAGGGTGAGGAAATACTGACT 0 false 0 sequence_with_flank actagtcattgattcgaagcATGTGAGGGTGAGGAAATACTGACTttaacctttgtgaagaaatc 0 false Homo sapiens OREG0000197 C/EBP-alpha (CEBP) C/EBP-alpha (CEBP) USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000167910 CYP7A1 ENSEMBL homo_sapiens_core_31_35d 127 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTGTGGACTTAGTTCAAGGCCA 0 false 0 sequence_with_flank tttggaaccacttctgatacCTGTGGACTTAGTTCAAGGCCAgttactaccacttttttttt 0 false Homo sapiens OREG0000198 ENSG00000101076 HNF4A (HNF4) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000167910 CYP7A1 ENSEMBL homo_sapiens_core_31_35d 128 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TGTTTGCTTTG 0 false 0 sequence_with_flank agaatgaacaaatggctaatTGTTTGCTTTGtcaaccaagctcaagttaat 0 false Homo sapiens OREG0000199 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000167910 CYP7A1 ENSEMBL homo_sapiens_core_31_35d 129 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AAGTTAATG 0 false 0 sequence_with_flank ttgctttgtcaaccaagctcAAGTTAATGgatctggatactatgtatat 0 false Homo sapiens OREG0000200 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000167910 CYP7A1 ENSEMBL homo_sapiens_core_31_35d 130 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TAGCTATGCCCATCTTAAACAGGTTTATT 0 false 0 sequence_with_flank attatagtttatgtatttatTAGCTATGCCCATCTTAAACAGGTTTATTtgttctttttacacatacca 0 false Homo sapiens OREG0000201 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 131 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AGTTAATCATTGGCC 0 false 0 sequence_with_flank actgccaagaagcatgccaaAGTTAATCATTGGCCctgctgagtacatggccgat 0 false Homo sapiens OREG0000202 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 132 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AAGAAGCATGCC 0 false 0 sequence_with_flank gggcagacccttgcactgccAAGAAGCATGCCaaagttaatcattggccctg 0 false Homo sapiens OREG0000203 ENSG00000101076 HNF4A (HNF4) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 133 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GCCAAAGTTAAT 0 false 0 sequence_with_flank cttgcactgccaagaagcatGCCAAAGTTAATcattggccctgctgagtaca 0 false Homo sapiens OREG0000204 ENSG00000101076 HNF4A (HNF4) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 134 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TGTGTGC 0 false 0 sequence_with_flank atggccgatcaggctgttttTGTGTGCctgtttttctattttacgta 0 false Homo sapiens OREG0000205 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 135 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TGTTTGC 0 false 0 sequence_with_flank tacgtaaatcaccctgaacaTGTTTGCatcaacctactggtgatgca 0 false Homo sapiens OREG0000206 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE This TF might be one gene in CRE family. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 136 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TTGCATCA 0 false 0 sequence_with_flank gtaaatcaccctgaacatgtTTGCATCAacctactggtgatgcacctt 0 false Homo sapiens OREG0000207 CRE CRE USER DEFINED TRANSCRIPTION FACTOR BINDING SITE CEBP has an aliase 1833 but there is no ensembl gene with HUGO ID 1833. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 137 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CAACCT 0 false 0 sequence_with_flank caccctgaacatgtttgcatCAACCTactggtgatgcacctttgat 0 false Homo sapiens OREG0000208 C/EBP-alpha (CEBP) C/EBP-alpha (CEBP) USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 138 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence ACAAACG 0 false 0 sequence_with_flank ctttgatcaatacattttagACAAACGtggtttttgagtccaaagat 0 false Homo sapiens OREG0000209 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 139 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GTTTTTGAG 0 false 0 sequence_with_flank atacattttagacaaacgtgGTTTTTGAGtccaaagatcagggctgggt 0 false Homo sapiens OREG0000210 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000131482 G6PC ENSEMBL homo_sapiens_core_31_35d 140 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CCAAAGA 0 false 0 sequence_with_flank gacaaacgtggtttttgagtCCAAAGAtcagggctgggttgacctga 0 false Homo sapiens OREG0000211 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000017427 IGF1 ENSEMBL homo_sapiens_core_31_35d 141 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GTTAATCAGAAAA 0 false 0 sequence_with_flank gtcttcatgcccagcagaaaGTTAATCAGAAAAcagatccttattttctatgg 0 false Homo sapiens OREG0000212 ENSG00000135100 TCF1 (HNF-1-alpha / HNF1A / HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000017427 IGF1 ENSEMBL homo_sapiens_core_31_35d 142 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTTACTCAATAAC 0 false 0 sequence_with_flank tcaccatgcccaaaaaagtcCTTACTCAATAACtttgccagaagagggagaga 0 false Homo sapiens OREG0000213 ENSG00000135100 TCF1 (HNF-1-alpha / HNF1A / HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000129965 INS ENSEMBL homo_sapiens_core_31_35d 143 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GGTTAAGACTCTAAT 0 false 0 sequence_with_flank ggtctggccaccgggcccctGGTTAAGACTCTAATgacccgctggtcctgaggaa 0 false Homo sapiens OREG0000214 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000171759 PAH ENSEMBL homo_sapiens_core_31_35d 144 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CTCATGGATTATGATTAACTCAACCTTC 0 false 0 sequence_with_flank ttttgtttctgtgccatgaaCTCATGGATTATGATTAACTCAACCTTCtgcacatgaagataaacaag 0 false Homo sapiens OREG0000215 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000171759 PAH ENSEMBL homo_sapiens_core_31_35d 145 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TGCAATGGTTGGGTAATCTTCAACTT 0 false 0 sequence_with_flank caagaaagaactgataaaccTGCAATGGTTGGGTAATCTTCAACTTccaaatcagcaaaggtcagc 0 false Homo sapiens OREG0000216 ENSG00000135100 TCF1 (HNF1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 146 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence CACTGTTTGTC 0 false 0 sequence_with_flank aggaccaggagtgctagtgcCACTGTTTGTCtatggagagggaggcctcag 0 false Homo sapiens OREG0000217 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 147 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TGGAGAGGGAGGC 0 false 0 sequence_with_flank ctagtgccactgtttgtctaTGGAGAGGGAGGCctcagtgctgagggccaagc 0 false Homo sapiens OREG0000218 ENSG00000141905 NFIC (NF-I) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 148 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AGGGCCA 0 false 0 sequence_with_flank agagggaggcctcagtgctgAGGGCCAagcaaatatttgtggttatg 0 false Homo sapiens OREG0000219 ENSG00000141905 NFIC (NF-I) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE This record has existed in KSL database already. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 149 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence AAGCAAATATTTGT 0 false 0 sequence_with_flank aggcctcagtgctgagggccAAGCAAATATTTGTggttatggattaactcgaac 0 false Homo sapiens OREG0000220 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 150 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TTGTGGTTAT 0 false 0 sequence_with_flank gctgagggccaagcaaatatTTGTGGTTATggattaactcgaactccagg 0 false Homo sapiens OREG0000221 C/EBP-alpha (CEBP) C/EBP-alpha (CEBP) USER DEFINED TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 151 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GGTTATGGATTAACT 0 false 0 sequence_with_flank agggccaagcaaatatttgtGGTTATGGATTAACTcgaactccaggctgtcatgg 0 false Homo sapiens OREG0000222 ENSG00000135100 TCF1 (HNF1/HNF-1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE This record can be thought to be the same as the previous one (index = 91) since they have the same Tf and overlapping binding sites from the same place in the sequence. 16-Aug-2005 mzhang 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 152 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence GTTATGGATTAAC 0 false 0 sequence_with_flank gggccaagcaaatatttgtgGTTATGGATTAACtcgaactccaggctgtcatg 0 false Homo sapiens OREG0000223 ENSG00000135100 TCF1 (HNF1/HNF-1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000115718 PROC ENSEMBL homo_sapiens_core_31_35d 153 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence ACCCGCCC 0 false 0 sequence_with_flank gaacttgcagtatctccacgACCCGCCCctgtgagtccccctccaggc 0 false Homo sapiens OREG0000224 ENSG00000185591 SP1 (Sp-1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000163581 SLC2A2 ENSEMBL homo_sapiens_core_31_35d 154 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence ACTTATTGATTAGATTC 0 false 0 sequence_with_flank acaggttgctgaggcaaagcACTTATTGATTAGATTCccatcaatattcagctgccg 0 false Homo sapiens OREG0000225 ENSG00000135100 TCF1 (HNF1/HNF-1) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000163581 SLC2A2 ENSEMBL homo_sapiens_core_31_35d 155 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence TATTGAT 0 false 0 sequence_with_flank ggttgctgaggcaaagcactTATTGATtagattcccatcaatattca 0 false Homo sapiens OREG0000226 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000163581 SLC2A2 ENSEMBL homo_sapiens_core_31_35d 156 POSITIVE OUTCOME 15933209 0 search_space EMPTY 0 false 0 sequence ATCAATA 0 false 0 sequence_with_flank cacttattgattagattcccATCAATAttcagctgccgctgagaaga 0 false Homo sapiens OREG0000227 ENSG00000111206 FOXM1 (HNF3) ENSEMBL homo_sapiens_core_31_35d TRANSCRIPTION FACTOR BINDING SITE 16-Aug-2005 16-Aug-2005 OREGEC00000 OREGES00000 OREGET00000 mzhang ENSG00000167165 UGT1A3 ENSEMBL homo_sapiens_core_31_35d 157 POSITIVE OUTCOME 15933209